G472340



Basic Information


Item Value
gene id G472340
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 10240443 ~ 10240739 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU537017
tgtcagtaacatctaaagaggagatatattgtatcagtaacatctaaagaggagatatattgtatctgtaacatctaaagaggagatatattgtatcagtaacatctaaagaggagatatattgtatctgtaacatctaaagaggagatatattgtatcagtaacatctaaagaggagatatattgtatctgtcagtaacatctaaagaggagatatattgtatctgtcagtaacatctaaagaggagatatattgtatctgtcagtaacatctaaagaggagatatattgtatctg

Function


GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU537017 True 297 lncRNA 0.30 1 10240443 10240739

Neighbor


gene id symbol gene type direction distance location
si:ch73-72b7.1 LOC106585820 coding downstream 282936 9644491 ~ 9957507 (-)
rtgdnf rtgdnf coding downstream 1044310 9194633 ~ 9196133 (-)
lmbrd2a LOC106585919 coding downstream 1237770 8988891 ~ 9002673 (-)
LOC110525229 LOC106585907 coding downstream 1344049 8894363 ~ 8896394 (-)
LOC110525230 bri3bp coding downstream 1355290 8877792 ~ 8885153 (-)
stpg2 stpg2 coding upstream 48277 10289016 ~ 10360380 (-)
smad4 smad4 coding upstream 129230 10369969 ~ 10381469 (-)
elac1 elac1 coding upstream 140887 10381626 ~ 10384394 (-)
me2 me2 coding upstream 145845 10386584 ~ 10414782 (-)
LOC110525243 mapk4 coding upstream 177639 10418378 ~ 10441341 (-)
G472322 NA non-coding downstream 15346 10224874 ~ 10225097 (-)
G472280 NA non-coding downstream 80714 10159400 ~ 10159729 (-)
G472277 NA non-coding downstream 86335 10153894 ~ 10154108 (-)
G472268 NA non-coding downstream 100158 10140081 ~ 10140285 (-)
G472200 NA non-coding downstream 118809 10121315 ~ 10121634 (-)
G472365 NA non-coding upstream 39546 10280285 ~ 10281008 (-)
G472368 NA non-coding upstream 42885 10283624 ~ 10288580 (-)
G472531 NA non-coding upstream 58160 10298899 ~ 10300504 (-)
G472573 NA non-coding upstream 159760 10400499 ~ 10464977 (-)
G472587 NA non-coding upstream 165989 10406728 ~ 10406989 (-)
G470834 NA other downstream 1942022 8296569 ~ 8298421 (-)
G469751 NA other downstream 2585825 7652639 ~ 7654618 (-)
G469411 NA other downstream 3075871 7159458 ~ 7164572 (-)
G469361 NA other downstream 3444448 6794427 ~ 6795995 (-)
G469368 LOC106593081 other downstream 3475530 6763822 ~ 6764913 (-)
G472539 NA other upstream 133113 10373852 ~ 10376077 (-)
G472576 mpeg1 other upstream 235670 10476409 ~ 10479846 (-)
LOC110525252 ccser1 other upstream 1138788 11280815 ~ 11390675 (-)
G473930 NA other upstream 1360776 11601515 ~ 11601997 (-)
G474030 NA other upstream 1501463 11742202 ~ 11742758 (-)

Expression


G472340 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G472340 Expression in each Bioproject

Bar chart with 11 bars.
G472340 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network