G476181



Basic Information


Item Value
gene id G476181
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 13887200 ~ 13887729 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU541326
caaaaagacaggattttgaaaaagtaactatttttcataaaattatacagttatcttagctagctgaattgttagctgaattgtttacatgttgctaagcagttgctaaggactctcctggaagaagctagctagcttacaaagaataacaaaaaaatatctagttaacagaagaaaggaagacaaaataaggacagaagaaaaaggaaaagaaaaaaggataacaaagtgaaacagtcctctgaagaaacaagagagcattatacaagaaacagcacttctattgcaacattgtagccaacatcaccagcgttgctatggaaattgtttacccaccagacatccaaacagagaaagctaagaaaagtttcaaaggtttgttgatgggacagaaccatgaatgcctgtttgcagatcttaccagttacaaaacaagagctaatttaatttttaataccaatcgagggaacatatggaaaaaggttatttgcaaccatttccctttctcaaaaaagaggggcatcagccaa

Function


NR:

description
PREDICTED: uncharacterized protein LOC107670751 isoform X1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU541326 True 530 lncRNA 0.35 1 13887200 13887729

Neighbor


gene id symbol gene type direction distance location
LOC110525299 LOC106585791 coding upstream 154140 13726709 ~ 13733060 (+)
LOC118965067 NA coding upstream 562405 13322042 ~ 13324795 (+)
aqp3a LOC106585799 coding upstream 933141 12940770 ~ 12954059 (+)
nol6 nol6 coding upstream 961252 12896951 ~ 12925948 (+)
arsk arsk coding upstream 991424 12888485 ~ 12895776 (+)
gig2p LOC106585755 coding downstream 754003 14641732 ~ 14644594 (+)
LOC110525306 LOC106585757 coding downstream 803835 14691564 ~ 14706855 (+)
LOC110525102 LOC106585759 coding downstream 819148 14706877 ~ 14718733 (+)
LOC110525103 LOC106585761 coding downstream 948414 14836143 ~ 14890175 (+)
LOC110525309 LOC106585763 coding downstream 1081761 14969490 ~ 14995677 (+)
G476180 NA non-coding upstream 3037 13883949 ~ 13884163 (+)
G476178 NA non-coding upstream 10230 13876734 ~ 13876970 (+)
G476177 NA non-coding upstream 10829 13876138 ~ 13876371 (+)
G476174 NA non-coding upstream 15274 13871703 ~ 13871926 (+)
G476170 NA non-coding upstream 46273 13840520 ~ 13840927 (+)
G476185 NA non-coding downstream 13304 13901033 ~ 13901316 (+)
G476190 NA non-coding downstream 26439 13914168 ~ 13914531 (+)
G476201 NA non-coding downstream 42199 13929928 ~ 13932437 (+)
G476208 NA non-coding downstream 57178 13944907 ~ 13945267 (+)
G476217 NA non-coding downstream 75828 13963557 ~ 13963771 (+)
G475692 NA other upstream 573231 13313679 ~ 13313969 (+)
G474949 NA other upstream 1173902 12712306 ~ 12713298 (+)
G474851 NA other upstream 1383081 12503760 ~ 12504119 (+)
G474321 NA other upstream 1696628 12188288 ~ 12190572 (+)
G473070 NA other upstream 2607935 11278338 ~ 11279265 (+)
G476234 NA other downstream 97111 13984840 ~ 13985259 (+)
G476248 NA other downstream 109355 13997084 ~ 14015564 (+)
G479239 NA other downstream 2471687 16359416 ~ 16359751 (+)
traf1 LOC106585784 other downstream 3091453 16970834 ~ 16982251 (+)
dab2ipa LOC106585786 other downstream 3213257 17016096 ~ 17126012 (+)

Expression


G476181 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G476181 Expression in each Bioproject

Bar chart with 20 bars.
G476181 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network