G479150



Basic Information


Item Value
gene id G479150
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 16259636 ~ 16260150 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU544552
TTCACTTCAAGGTTTAAAACTCCAGCCTGCCACTTCACTTCAAGGTTTTAAACTCCAGCATTGTGCTTCATTTCAAGGTTTTAAACTCCAGCATTGTGCTTCACTTCAAGGTTTTAAACTCCAGCATTGTGCTTCACTTCAAGGTTTTAAACTCCAGCATTGTGCTTCACTTCAAGGTTTTAAACTCCAGCATTGTGCTTCACTTCAAGGTTTTAAACTCCAGCATTGTGCTTCACTTCAAGGTTTGAAATTCCAGCTGGCCACTTCACTTCAAGGTTTTAAACTCCAGCATTGTGCTTCACTTCAAGGTTTTAAACTCCAGCATTGTGCTTCACTTCAAGGTTTGAAACTCCGGCCTGCTAGGCAGAGTGGAACCTTGTGAACACCACCAACCTCTCTCTGAGCTCTGCCGATGGATGCTTTCAGCTGGCTGTCACTGTGGACAAGCC

Function


NR:

description
hypothetical protein EH28_03027

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU544552 True 449 lncRNA 0.44 2 16259636 16260150
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110525316 NA coding downstream 90112 16085395 ~ 16169524 (-)
LOC110525314 LOC106585770 coding downstream 210702 16017955 ~ 16048934 (-)
LOC118965069 NA coding downstream 336534 15921001 ~ 15923102 (-)
LOC110525008 NA coding downstream 347725 15909810 ~ 15911911 (-)
LOC118965068 NA coding downstream 358916 15898619 ~ 15900720 (-)
LOC110525318 rxra coding upstream 277971 16538121 ~ 16574149 (-)
LOC110525321 cssa24h9orf116 coding upstream 425643 16685793 ~ 16694405 (-)
LOC110525322 LOC106585778 coding upstream 447106 16707256 ~ 16730072 (-)
LOC110525323 stkld1 coding upstream 470639 16730789 ~ 16739097 (-)
endog endog coding upstream 873690 17133840 ~ 17135672 (-)
G479091 NA non-coding downstream 39515 16151264 ~ 16220121 (-)
G479095 NA non-coding downstream 42635 16164456 ~ 16217001 (-)
G479055 NA non-coding downstream 188437 16070975 ~ 16071199 (-)
G479051 NA non-coding downstream 196775 16062642 ~ 16062861 (-)
G479236 NA non-coding upstream 97631 16357781 ~ 16358043 (-)
G479262 NA non-coding upstream 121051 16381201 ~ 16381414 (-)
G479267 NA non-coding upstream 124567 16384717 ~ 16385425 (-)
G479288 NA non-coding upstream 141680 16401830 ~ 16402129 (-)
G479326 NA non-coding upstream 176689 16436839 ~ 16437068 (-)
G478734 NA other downstream 376126 15881636 ~ 15883510 (-)
G478730 LOC106585767 other downstream 387838 15869799 ~ 15871798 (-)
G478643 NA other downstream 530053 15727490 ~ 15730279 (-)
G477528 LOC106585763 other downstream 1303586 14954093 ~ 14956050 (-)
fam172a LOC106585793 other downstream 2171955 13758198 ~ 14087746 (-)
G479533 NA other upstream 329122 16589272 ~ 16593771 (-)
git2a LOC106585671 other upstream 1797061 18056651 ~ 18084926 (-)
LOC110525370 LOC106585675 other upstream 1863947 18121017 ~ 18139654 (-)
G482323 NA other upstream 2697336 18957486 ~ 18963891 (-)

Expression


G479150 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G479150 Expression in each Bioproject

Bar chart with 15 bars.
G479150 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 14.
End of interactive chart.

Co-expression Network