G489307



Basic Information


Item Value
gene id G489307
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 25406046 ~ 25406667 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU556104
GCCGGATGTTTTCTGTGTTATGCACAGTGAGTCCATCACTGCTAGCTAGGGCATGTAGCAAGGGTGATTTTCCATTTTTATCTCTTGCATTCACGTCAGCACCCATGTCCAGCAGTGTGCACATACAAGGCAGTCTCTCTGCCTCTTCACTAGCGAGATCCAAGGGGCTACTTTCAT

Function


NR:

description
ankyrin repeat and SOCS box protein 6 isoform X1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU556104 True 177 lncRNA 0.49 2 25406046 25406667

Neighbor


gene id symbol gene type direction distance location
LOC110525591 LOC106579906 coding downstream 30564 25172861 ~ 25375482 (-)
LOC110525589 LOC106585529 coding downstream 488194 24911627 ~ 24917852 (-)
piwil1 piwil1 coding downstream 521041 24873223 ~ 24885005 (-)
LOC110525585 LOC106585524 coding downstream 690956 24655788 ~ 24715090 (-)
ep400 LOC106579917 coding downstream 771688 24597970 ~ 24634358 (-)
LOC110525597 NA coding upstream 42352 25449019 ~ 25451212 (-)
LOC110525601 LOC106585539 coding upstream 236565 25643232 ~ 25660249 (-)
lmx1bb LOC106585540 coding upstream 297507 25704174 ~ 25768796 (-)
pbx3b LOC106585542 coding upstream 572287 25978954 ~ 26067633 (-)
LOC110525604 LOC106585543 coding upstream 827885 26234552 ~ 26264035 (-)
G489302 NA non-coding downstream 2664 25403030 ~ 25403382 (-)
G489237 NA non-coding downstream 18935 25386760 ~ 25387111 (-)
G489224 NA non-coding downstream 31982 25373805 ~ 25374064 (-)
G489212 NA non-coding downstream 54707 25351113 ~ 25351339 (-)
G489211 NA non-coding downstream 54970 25350801 ~ 25351076 (-)
G489315 NA non-coding upstream 10223 25416890 ~ 25417207 (-)
G489316 NA non-coding upstream 11344 25418011 ~ 25418217 (-)
G489317 NA non-coding upstream 12861 25419528 ~ 25419782 (-)
G489311 NA non-coding upstream 26847 25433514 ~ 25434613 (-)
G489328 NA non-coding upstream 28776 25435443 ~ 25435959 (-)
G489038 NA other downstream 299476 25106205 ~ 25106570 (-)
G488386 NA other downstream 1052223 24353533 ~ 24353823 (-)
LOC110525552 LOC106585495 other downstream 1688263 23713875 ~ 23717830 (-)
LOC110525180 hps4 other downstream 1820492 23582127 ~ 23587892 (-)
G489511 hmcn2 other upstream 90296 25496963 ~ 25497489 (-)
LOC110525606 LOC106585545 other upstream 873040 26271759 ~ 26283169 (-)
tmem230b LOC106585554 other upstream 1049065 26455731 ~ 26457883 (-)
LOC110525619 LOC106585557 other upstream 1140555 26481087 ~ 26551627 (-)
G491291 NA other upstream 1418200 26824867 ~ 26867158 (-)

Expression



Co-expression Network