G489267



Basic Information


Item Value
gene id G489267
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 25434932 ~ 25435215 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU556064
TAGAGTTTTCAAATGGGAGTGTAGCATTAACAAAGTGGAATTCTGGCAATATACATTATCAGGTTTAAAACTGGCTATTCAATTTGCAAGAAGTATTCTATACCTTACTTTTTCTTGAGAAGGTTGCAGGTAGTCTCTTCTGCTGTCTATCATAAGGATGCTACCTGGACCTGGAGTGGTAAAATATTAATAAAACACAATTTCTCTGCCTCCACCCTCATCTCTATCCTGCTCTTCCCCCTACATCGCTCTATCTCCCCTTGTTGTTCCACCCTCATCTCTAT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU556064 True 284 lncRNA 0.40 1 25434932 25435215
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110525594 NA coding upstream 245 25426294 ~ 25434687 (+)
asb6 asb6 coding upstream 26700 25404469 ~ 25408232 (+)
LOC110525592 LOC106585533 coding upstream 35002 25391698 ~ 25399930 (+)
LOC110525590 LOC106585531 coding upstream 272802 25115383 ~ 25162130 (+)
LOC110525720 LOC106585530 coding upstream 379957 24997564 ~ 25054975 (+)
LOC110525596 LOC106585340 coding downstream 2281 25437496 ~ 25439088 (+)
LOC110525595 crat coding downstream 4566 25439781 ~ 25449371 (+)
LOC110525598 ncs1 coding downstream 26131 25461346 ~ 25492564 (+)
hmcn2 hmcn2 coding downstream 61629 25496844 ~ 25557967 (+)
LOC110525599 LOC106585538 coding downstream 161434 25596649 ~ 25624515 (+)
G489258 NA non-coding upstream 21715 25412972 ~ 25413217 (+)
G489247 NA non-coding upstream 25332 25409100 ~ 25409600 (+)
G489239 NA non-coding upstream 45350 25389370 ~ 25389582 (+)
G489007 NA non-coding upstream 59453 25374367 ~ 25375479 (+)
G489255 NA non-coding downstream 19831 25455046 ~ 25459348 (+)
G489428 NA non-coding downstream 221228 25656443 ~ 25656666 (+)
G489430 NA non-coding downstream 224722 25659937 ~ 25660221 (+)
G489431 NA non-coding downstream 225262 25660477 ~ 25660949 (+)
G489737 NA non-coding downstream 363127 25798342 ~ 25798568 (+)
G488258 NA other upstream 495660 24938769 ~ 24939272 (+)
G488078 NA other upstream 803536 24630969 ~ 24631396 (+)
G488049 NA other upstream 848619 24579961 ~ 24586313 (+)
LOC110525563 LOC106585507 other upstream 1520682 23911741 ~ 23914297 (+)
G487146 LOC106585492 other upstream 1767005 23653120 ~ 23667927 (+)
si:dkey-191c17.2 LOC106585342 other downstream 203646 25638816 ~ 25641178 (+)
G489447 NA other downstream 248471 25683686 ~ 25684311 (+)
LOC110525642 bin3 other downstream 2053381 27488557 ~ 27543022 (+)
LOC110525650 LOC106585598 other downstream 2344415 27738953 ~ 27793944 (+)
LOC110525669 NA other downstream 2936507 28370701 ~ 28373267 (+)

Expression


G489267 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G489267 Expression in each Bioproject

Bar chart with 7 bars.
G489267 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network