G489447



Basic Information


Item Value
gene id G489447
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 25683686 ~ 25684311 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU556254
gaccatatcacctccaccctacctgacaccctagacccactccaatttgcttaccgcccaaataggtccacagatgatgcaatctcaaccacactgcacactgccctaacccatctggacaagaggaatacctatgtgagaatgctgttcatcgactacagctcggcatttaacaccatagtgccctccaagttcgtcatcaagctcgaggccctgggtctcgaccccgccctgtgcaactgggtactggacttcctgacgggccgcccccaggtggtgagggtaggcaacaacatctccaccccgctgatcctcaacactggggccccacaagggtgcgttctgagccctctcctgtactccctgttcacccacgactgcgtggccatgcacgcctccaactcaatcatcaagtttgcggacgacacaacagtggtaggcttgattaccaacaacaacgagacggcctacagggaggaggtgagggccctcggagtgtggtgtcaggaaaataacctcaccctcaacgtcaacaaaactaaggagatgattgtggacttcaggaaacagcagagggaacacccccctatccacatcgatggaacagtagtggagagggtagtaag

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU556254 True 626 TUCP 0.55 1 25683686 25684311
Loading

Neighbor


gene id symbol gene type direction distance location
si:dkey-191c17.2 LOC106585342 coding upstream 42508 25638816 ~ 25641178 (+)
LOC110525599 LOC106585538 coding upstream 59171 25596649 ~ 25624515 (+)
LOC118965109 NA coding upstream 74682 25608951 ~ 25609004 (+)
hmcn2 hmcn2 coding upstream 125719 25496844 ~ 25557967 (+)
LOC110525598 ncs1 coding upstream 191122 25461346 ~ 25492564 (+)
LOC110525609 LOC106585547 coding downstream 654859 26339170 ~ 26345174 (+)
LOC110525610 LOC106585548 coding downstream 681662 26365973 ~ 26382809 (+)
LOC110525613 LOC106585551 coding downstream 707115 26391426 ~ 26394660 (+)
LOC110525019 LOC106585553 coding downstream 716561 26400872 ~ 26403077 (+)
adra1aa LOC106585343 coding downstream 802103 26476668 ~ 26497696 (+)
G489431 NA non-coding upstream 22737 25660477 ~ 25660949 (+)
G489430 NA non-coding upstream 23465 25659937 ~ 25660221 (+)
G489428 NA non-coding upstream 27020 25656443 ~ 25656666 (+)
G489255 NA non-coding upstream 224338 25455046 ~ 25459348 (+)
G489267 NA non-coding upstream 248471 25434932 ~ 25435215 (+)
G489737 NA non-coding downstream 114031 25798342 ~ 25798568 (+)
G489759 NA non-coding downstream 127840 25812151 ~ 25812367 (+)
G489783 NA non-coding downstream 139941 25824252 ~ 25824510 (+)
G489798 NA non-coding downstream 150445 25834756 ~ 25835073 (+)
G489858 NA non-coding downstream 190600 25874911 ~ 25875219 (+)
G488258 NA other upstream 744414 24938769 ~ 24939272 (+)
G488078 NA other upstream 1052290 24630969 ~ 24631396 (+)
G488049 NA other upstream 1097373 24579961 ~ 24586313 (+)
LOC110525563 LOC106585507 other upstream 1769436 23911741 ~ 23914297 (+)
LOC110525642 bin3 other downstream 1804285 27488557 ~ 27543022 (+)
LOC110525650 LOC106585598 other downstream 2095319 27738953 ~ 27793944 (+)
LOC110525669 NA other downstream 2687411 28370701 ~ 28373267 (+)
G493450 NA other downstream 3305119 28989430 ~ 28990734 (+)
LOC110525701 LOC106585276 other downstream 4187701 29871980 ~ 29880651 (+)

Expression


G489447 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G489447 Expression in each Bioproject

Bar chart with 20 bars.
G489447 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network