G491598



Basic Information


Item Value
gene id G491598
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 27316878 ~ 27317100 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU558634
acctaactgggagtctcgtgagtgaaaacatccgaagctcatcaaaggtaaacgatttaatttgattgcttttctgatttccgtgaccaagttacctgctgctagctggacaaaatgctatgctaggctatcgataaacttacacaaatgcttgtctagctttggctgtaaagcatattttgaaaatctgagatgacaggatgattaacaaaaggctatgctg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU558634 True 223 lncRNA 0.39 1 27316878 27317100
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110525638 LOC106585585 coding downstream 38327 27270821 ~ 27278551 (-)
LOC110525021 nkx31 coding downstream 64501 27251058 ~ 27252377 (-)
LOC110525629 LOC106585566 coding downstream 428573 26883863 ~ 26888305 (-)
LOC118965120 NA coding downstream 439424 26877322 ~ 26877454 (-)
LOC110525627 LOC106585561 coding downstream 440835 26828158 ~ 26876043 (-)
LOC110525639 LOC106579858 coding upstream 25845 27342945 ~ 27351891 (-)
LOC110525643 LOC106585590 coding upstream 228508 27545608 ~ 27560556 (-)
LOC110525644 LOC106585592 coding upstream 244457 27561557 ~ 27578521 (-)
LOC110525648 LOC106585594 coding upstream 335685 27652785 ~ 27705710 (-)
LOC110525649 LOC106585595 coding upstream 397031 27714131 ~ 27724003 (-)
G491497 NA non-coding downstream 124520 27153706 ~ 27192358 (-)
G491492 NA non-coding downstream 171572 27144879 ~ 27145306 (-)
G491435 LOC106585567 non-coding downstream 176124 27138156 ~ 27140754 (-)
G491475 LOC106585563 non-coding downstream 206740 27109374 ~ 27110138 (-)
G491417 LOC106585572 non-coding downstream 277004 27039044 ~ 27039874 (-)
G491602 NA non-coding upstream 3029 27320129 ~ 27320361 (-)
G491603 NA non-coding upstream 3308 27320408 ~ 27320638 (-)
G492067 NA non-coding upstream 179077 27496177 ~ 27506760 (-)
G492122 NA non-coding upstream 284245 27601345 ~ 27601642 (-)
G492127 NA non-coding upstream 289585 27606685 ~ 27607004 (-)
G491539 NA other downstream 72685 27216607 ~ 27244193 (-)
G491291 NA other downstream 449720 26824867 ~ 26867158 (-)
LOC110525619 LOC106585557 other downstream 765251 26481087 ~ 26551627 (-)
tmem230b LOC106585554 other downstream 859037 26455731 ~ 26457883 (-)
LOC110525606 LOC106585545 other downstream 1033709 26271759 ~ 26283169 (-)
LOC110525653 NA other upstream 417896 27734995 ~ 27737024 (-)
LOC110525655 LOC106585601 other upstream 510131 27827231 ~ 27885634 (-)
G494389 LOC106585296 other upstream 2094115 29411215 ~ 29415314 (-)
LOC110525681 hectd4 other upstream 2161555 29411204 ~ 29483533 (-)
LOC110525684 LOC106585295 other upstream 2185153 29502192 ~ 29520980 (-)

Expression


G491598 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G491598 Expression in each Bioproject

Bar chart with 16 bars.
G491598 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network