G497704



Basic Information


Item Value
gene id G497704
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 32937884 ~ 32938314 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU565463
gggacagtgcacattaatcaacgtttcagtaaaagtgccggttttagccagccggctaattttcaaccgcagtccctgggcaggttattaaaaacaattacaatatggacaatagcaacataggacaagcaagacatagcatacagacagagcaacataggacaagcaagacatagcatacagacagagcaacataggacaagcaagacatagcatacagacagagcaacataggacaagcaagacatagcatacagacagagcaacataggacaagcaagacatagcatacagacagagcaacataggacaagcaagacatagcatacagacagagcaacataggacaagcaagacgtagcatacagacagagcaacataggacaagcaagacgtagcatacagacagagcaacataggacaagcaagac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU565463 True 431 lncRNA 0.44 1 32937884 32938314
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110525788 LOC106585037 coding downstream 13474 32883925 ~ 32924410 (-)
LOC110525787 LOC106585035 coding downstream 177933 32750665 ~ 32759951 (-)
LOC110525785 LOC106585030 coding downstream 207208 32690707 ~ 32730676 (-)
LOC110525784 LOC106585031 coding downstream 254985 32680037 ~ 32682899 (-)
LOC110526888 LOC106585027 coding downstream 416984 32508680 ~ 32520900 (-)
LOC110525792 LOC106585039 coding upstream 8720 32947034 ~ 32962214 (-)
LOC110525797 LOC106585042 coding upstream 135387 33073701 ~ 33076106 (-)
LOC110525798 LOC106585045 coding upstream 160752 33099066 ~ 33103756 (-)
LOC110525800 ergi2 coding upstream 176382 33114696 ~ 33130672 (-)
LOC118965074 NA coding upstream 254956 33193270 ~ 33197445 (-)
G497699 NA non-coding downstream 7113 32927593 ~ 32930771 (-)
G497698 NA non-coding downstream 10352 32927309 ~ 32927532 (-)
G497663 NA non-coding downstream 110940 32825857 ~ 32826944 (-)
G497573 LOC106585028 non-coding downstream 274631 32658242 ~ 32663253 (-)
G497518 NA non-coding downstream 325366 32588068 ~ 32612518 (-)
G497707 NA non-coding upstream 3900 32942214 ~ 32942494 (-)
G497708 NA non-coding upstream 5887 32944201 ~ 32944747 (-)
G498324 NA non-coding upstream 67121 33005435 ~ 33005636 (-)
G498334 NA non-coding upstream 76572 33014886 ~ 33023041 (-)
G498447 NA non-coding upstream 250808 33189122 ~ 33189398 (-)
G496851 NA other downstream 1045235 31843463 ~ 31892649 (-)
G496777 NA other downstream 1265957 31670978 ~ 31671927 (-)
G496772 NA other downstream 1276266 31661393 ~ 31661618 (-)
G495560 NA other downstream 2362311 30575118 ~ 30575573 (-)
G498484 rpl6 other upstream 389193 33327507 ~ 33330504 (-)
LOC110525812 LOC103397138 other upstream 394336 33332650 ~ 33336818 (-)
G498960 NA other upstream 1102045 34040359 ~ 34041174 (-)
G501142 NA other upstream 2827052 35765366 ~ 35767929 (-)
hk2 LOC106585103 other upstream 3569742 36507843 ~ 36569143 (-)

Expression


G497704 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G497704 Expression in each Bioproject

Bar chart with 19 bars.
G497704 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network