G497925



Basic Information


Item Value
gene id G497925
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 33347075 ~ 33347369 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU565697
gtactgcgagcatgcgctgaccaactggcaagtgtcttcactgacattttcagcctgtagccatgaagtgctttgaaaggcttgtcatggctcacatcaacaccattatcccagaaaccctagacccactccaatttgcataccgccccaacagatccacagatgatgcaatctctattgcactctacactgccctttcccacctggacaaaaggaacacctatgtgagaatgctattcattgactacagctcagtgttcaacaccatagtgccctcaaagctcatcaataagct

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU565697 True 295 lncRNA 0.47 1 33347075 33347369

Neighbor


gene id symbol gene type direction distance location
LOC110525811 rpl6 coding upstream 15478 33327503 ~ 33331597 (+)
LOC110525808 LOC106585052 coding upstream 20687 33321939 ~ 33326388 (+)
c6h22orf39 cssa24h22orf39 coding upstream 26722 33317578 ~ 33320353 (+)
LOC110525806 LOC106585051 coding upstream 29900 33313355 ~ 33317175 (+)
LOC110525805 LOC106585050 coding upstream 66127 33279198 ~ 33280948 (+)
LOC110525814 LOC106585056 coding downstream 5303 33352672 ~ 33367435 (+)
LOC110525815 LOC106585058 coding downstream 73044 33420413 ~ 33439671 (+)
LOC110525816 LOC106585060 coding downstream 99877 33447246 ~ 33465055 (+)
LOC110525817 LOC106585059 coding downstream 118623 33465992 ~ 33508271 (+)
LOC110525819 slc25a1 coding downstream 167881 33515250 ~ 33568701 (+)
G497921 LOC103397138 non-coding upstream 10340 33332650 ~ 33336735 (+)
G497855 NA non-coding upstream 137286 33208850 ~ 33209789 (+)
G497853 NA non-coding upstream 147584 33199265 ~ 33199491 (+)
G497852 NA non-coding upstream 148536 33198142 ~ 33198539 (+)
G497849 NA non-coding upstream 149687 33193078 ~ 33197388 (+)
G497933 NA non-coding downstream 21345 33368714 ~ 33368925 (+)
G497939 NA non-coding downstream 31537 33378906 ~ 33379166 (+)
G497944 NA non-coding downstream 37255 33384624 ~ 33384857 (+)
G497945 NA non-coding downstream 37792 33385161 ~ 33385378 (+)
G497946 NA non-coding downstream 38358 33385727 ~ 33386632 (+)
LOC110525799 LOC106585046 other upstream 182814 33135282 ~ 33165186 (+)
polk polk other upstream 418224 32926258 ~ 32936958 (+)
G495920 LOC106584987 other upstream 2034338 31294946 ~ 31312737 (+)
si:ch211-225b11.4 LOC106584980 other upstream 2336471 31006547 ~ 31022524 (+)
G499111 NA other downstream 803771 34151140 ~ 34151737 (+)
fancc fancc other downstream 5922590 39269915 ~ 39312098 (+)
LOC110525927 smim15 other downstream 6326643 39673964 ~ 39680031 (+)
LOC110525928 LOC106585161 other downstream 6387415 39734703 ~ 39750180 (+)

Expression


G497925 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 60.
End of interactive chart.

G497925 Expression in each Bioproject

Bar chart with 20 bars.
G497925 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2000.
End of interactive chart.

Co-expression Network