G506167



Basic Information


Item Value
gene id G506167
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 40274052 ~ 40274270 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU574678
CTCAAGTGGTAAAATGAAAACTAATGAATTTAGCAATAATAGTTTTATTTTTAGCCTAAATCTAGCATGTCGCGTACCCACATTTAAAACTTTAGCTTACAGAACAAGAAAAAACTTCACAGTTGTCAGGATGGCCAAGCGGTCTAATGCGCCAGCATGAAAGAGTGAATTCTTCCTGGAGACAGGGGATTTCTGGTCTATGAATGTAGATGTGAGTTC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU574678 True 219 lncRNA 0.38 1 40274052 40274270
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110525949 LOC106585178 coding upstream 15002 40256994 ~ 40259050 (+)
LOC110525947 LOC106585175 coding upstream 58598 40204903 ~ 40215454 (+)
LOC110525945 LOC106585174 coding upstream 82244 40185171 ~ 40191808 (+)
LOC110525943 NA coding upstream 95956 40172320 ~ 40178096 (+)
LOC118965025 NA coding upstream 108438 40160164 ~ 40165614 (+)
LOC110525953 LOC106584961 coding downstream 12196 40286466 ~ 40309855 (+)
LOC110525028 fabpl coding downstream 40593 40314863 ~ 40317433 (+)
LOC118965077 NA coding downstream 60069 40334257 ~ 40335548 (+)
LOC118964866 fabpl coding downstream 77142 40351412 ~ 40354009 (+)
LOC110525029 fabpl coding downstream 95895 40370165 ~ 40372761 (+)
G506165 LOC106584960 non-coding upstream 1401 40271324 ~ 40272651 (+)
G506164 LOC106584960 non-coding upstream 2821 40269285 ~ 40271231 (+)
G506157 NA non-coding upstream 13171 40259170 ~ 40260881 (+)
G506096 NA non-coding upstream 77305 40194588 ~ 40196747 (+)
G506169 NA non-coding downstream 4752 40279022 ~ 40279306 (+)
G506170 NA non-coding downstream 5115 40279385 ~ 40279614 (+)
G506179 NA non-coding downstream 16023 40290293 ~ 40290528 (+)
G506185 NA non-coding downstream 19578 40293848 ~ 40294017 (+)
G506186 NA non-coding downstream 21657 40295927 ~ 40296218 (+)
G506095 atp5a1 other upstream 70166 40196800 ~ 40203886 (+)
G505988 NA other upstream 310954 39962652 ~ 39963098 (+)
LOC110525928 LOC106585161 other upstream 525572 39734703 ~ 39750180 (+)
LOC110525927 smim15 other upstream 594021 39673964 ~ 39680031 (+)
G506281 LOC106585187 other downstream 270593 40544863 ~ 40547513 (+)
G506285 NA other downstream 291797 40566067 ~ 40566429 (+)
fbxl17 fbxl17 other downstream 294456 40568637 ~ 40886427 (+)
G507768 LOC105030512 other downstream 1195281 41469551 ~ 41471408 (+)
G508559 dph7 other downstream 1854955 42129225 ~ 42131940 (+)

Expression


G506167 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G506167 Expression in each Bioproject

Bar chart with 6 bars.
G506167 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 6.
End of interactive chart.

Co-expression Network