G509736



Basic Information


Item Value
gene id G509736
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 43028529 ~ 43028728 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU578540
aaatgatgtaaaatatatcactagccactttaaacaatgctacctaatataatgttccctacattactcatctcatatgtatatgtatatactgtactctatatcatctactgcatccttatgtaatgcatgtatcactagccactttaactatgccactttgtttacatactcatctcatatgtatatactgtactcaa

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU578540 True 200 lncRNA 0.31 1 43028529 43028728
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118965079 NA coding upstream 3831 43023780 ~ 43024698 (+)
col27a1b LOC106585224 coding upstream 36298 42853787 ~ 42992257 (+)
LOC118965026 LOC106585222 coding upstream 192423 42829811 ~ 42836106 (+)
LOC110525999 LOC106585222 coding upstream 203371 42810314 ~ 42825158 (+)
LOC118964872 NA coding upstream 247738 42779261 ~ 42780791 (+)
LOC110526005 LOC106585229 coding downstream 927449 43937835 ~ 43981885 (+)
LOC118964874 NA coding downstream 964105 43992833 ~ 43995155 (+)
LOC110526008 NA coding downstream 1230368 44259096 ~ 44260124 (+)
LOC110526009 LOC106585233 coding downstream 1256124 44284852 ~ 44295238 (+)
LOC110526012 LOC106585234 coding downstream 1266886 44295614 ~ 44309360 (+)
G509734 NA non-coding upstream 2086 43026167 ~ 43026443 (+)
G509719 NA non-coding upstream 26520 43001732 ~ 43002009 (+)
G509700 NA non-coding upstream 54507 42973774 ~ 42974022 (+)
G509740 NA non-coding downstream 8309 43037037 ~ 43042996 (+)
G509741 NA non-coding downstream 12180 43040908 ~ 43046262 (+)
G509763 NA non-coding downstream 45366 43074094 ~ 43074733 (+)
G509922 NA non-coding downstream 64520 43093248 ~ 43093475 (+)
G509923 NA non-coding downstream 65015 43093743 ~ 43094013 (+)
G509160 NA other upstream 458360 42567105 ~ 42570169 (+)
G508559 dph7 other upstream 896589 42129225 ~ 42131940 (+)
G507768 LOC105030512 other upstream 1557121 41469551 ~ 41471408 (+)
fbxl17 fbxl17 other upstream 2169007 40568637 ~ 40886427 (+)
G506285 NA other upstream 2462100 40566067 ~ 40566429 (+)
G510416 NA other downstream 628740 43657468 ~ 43658493 (+)
G512192 LOC106584908 other downstream 2155711 45184439 ~ 45185869 (+)
LOC110526028 ccdc60 other downstream 2188999 45187119 ~ 45236944 (+)
G512912 NA other downstream 2606861 45635589 ~ 45636250 (+)
LOC110526042 LOC106584891 other downstream 3158272 46076084 ~ 46190292 (+)

Expression


G509736 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G509736 Expression in each Bioproject

Bar chart with 9 bars.
G509736 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 12.
End of interactive chart.

Co-expression Network