G509763



Basic Information


Item Value
gene id G509763
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 43074094 ~ 43074733 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU578569
atgacatggagccagtgggtttggcgacgagtatgaagcgagggccagccaacgagagcgtacaggtcgcaatggtgggtagtatatggggctttggtgacaaaacggattgcactgtgatagactgcatccaatttgttgagtagggttttggaggctattttgtaaatgacatcgccaaagtcgaggattggtaggatggtcagttttacaagggtatgtttggcagcatgagtgaaggatgctttgttgcgaaataggaagccaattctagatttaactttggattggagatgtttgatatgggtctggaagtagagtttacagtctaaccagacacctaagtatttgtagttgtccacgtattctaagtcagagccgtccagagtagtgatgttggacaggcgggtaggtgcaggtagcgatcggttgaagagcatgcatttagttttacttgtatttgagagcaattggaggccacggaaggagagttgtatggcattgaagcttgcctggagggttgttaacacagtgtccaaagaagggccggaagtatacagaatggtgtcgtctgcgtagaggtggatcagagactcaccagcagcaagagcgacctcattgatgtatacagagaagagag

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU578569 True 640 lncRNA 0.47 1 43074094 43074733
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118965079 NA coding upstream 49396 43023780 ~ 43024698 (+)
col27a1b LOC106585224 coding upstream 81863 42853787 ~ 42992257 (+)
LOC118965026 LOC106585222 coding upstream 237988 42829811 ~ 42836106 (+)
LOC110525999 LOC106585222 coding upstream 248936 42810314 ~ 42825158 (+)
LOC118964872 NA coding upstream 293303 42779261 ~ 42780791 (+)
LOC110526005 LOC106585229 coding downstream 881444 43937835 ~ 43981885 (+)
LOC118964874 NA coding downstream 918100 43992833 ~ 43995155 (+)
LOC110526008 NA coding downstream 1184363 44259096 ~ 44260124 (+)
LOC110526009 LOC106585233 coding downstream 1210119 44284852 ~ 44295238 (+)
LOC110526012 LOC106585234 coding downstream 1220881 44295614 ~ 44309360 (+)
G509741 NA non-coding upstream 27832 43040908 ~ 43046262 (+)
G509740 NA non-coding upstream 31098 43037037 ~ 43042996 (+)
G509736 NA non-coding upstream 45366 43028529 ~ 43028728 (+)
G509734 NA non-coding upstream 47651 43026167 ~ 43026443 (+)
G509922 NA non-coding downstream 18515 43093248 ~ 43093475 (+)
G509923 NA non-coding downstream 19010 43093743 ~ 43094013 (+)
G509924 NA non-coding downstream 19488 43094221 ~ 43094515 (+)
G509930 NA non-coding downstream 33472 43108205 ~ 43108491 (+)
G509931 NA non-coding downstream 34042 43108775 ~ 43112219 (+)
G509160 NA other upstream 503925 42567105 ~ 42570169 (+)
G508559 dph7 other upstream 942154 42129225 ~ 42131940 (+)
G507768 LOC105030512 other upstream 1602686 41469551 ~ 41471408 (+)
fbxl17 fbxl17 other upstream 2214572 40568637 ~ 40886427 (+)
G506285 NA other upstream 2507665 40566067 ~ 40566429 (+)
G510416 NA other downstream 582735 43657468 ~ 43658493 (+)
G512192 LOC106584908 other downstream 2109706 45184439 ~ 45185869 (+)
LOC110526028 ccdc60 other downstream 2142994 45187119 ~ 45236944 (+)
G512912 NA other downstream 2560856 45635589 ~ 45636250 (+)
LOC110526042 LOC106584891 other downstream 3112267 46076084 ~ 46190292 (+)

Expression


G509763 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G509763 Expression in each Bioproject

Bar chart with 19 bars.
G509763 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network