G509968



Basic Information


Item Value
gene id G509968
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 43139610 ~ 43139843 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU578785
accaaacatgtggaagaaggtgctctggtcagatgaaaccaaaattgaactttttggcaacaatgcaaaacgtggcgtaaaagcaacacagctgaacacaccatccccactgtcaaacatggtggtggcagcatcatggtttgggcctgcttttcttcagcagggacagggaagatggttaaaattgatgggaagatggatggagccaaatacaggaccattctggaagaaaac

Function


NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU578785 True 234 lncRNA 0.46 1 43139610 43139843

Neighbor


gene id symbol gene type direction distance location
LOC118965079 NA coding upstream 114912 43023780 ~ 43024698 (+)
col27a1b LOC106585224 coding upstream 147379 42853787 ~ 42992257 (+)
LOC118965026 LOC106585222 coding upstream 303504 42829811 ~ 42836106 (+)
LOC110525999 LOC106585222 coding upstream 314452 42810314 ~ 42825158 (+)
LOC118964872 NA coding upstream 358819 42779261 ~ 42780791 (+)
LOC110526005 LOC106585229 coding downstream 816334 43937835 ~ 43981885 (+)
LOC118964874 NA coding downstream 852990 43992833 ~ 43995155 (+)
LOC110526008 NA coding downstream 1119253 44259096 ~ 44260124 (+)
LOC110526009 LOC106585233 coding downstream 1145009 44284852 ~ 44295238 (+)
LOC110526012 LOC106585234 coding downstream 1155771 44295614 ~ 44309360 (+)
G509948 LOC106578716 non-coding upstream 15990 43122505 ~ 43123620 (+)
G509931 NA non-coding upstream 27391 43108775 ~ 43112219 (+)
G509930 NA non-coding upstream 31119 43108205 ~ 43108491 (+)
G509924 NA non-coding upstream 45095 43094221 ~ 43094515 (+)
G509923 NA non-coding upstream 45597 43093743 ~ 43094013 (+)
G509971 NA non-coding downstream 1765 43141608 ~ 43141901 (+)
G509975 NA non-coding downstream 3286 43143129 ~ 43143365 (+)
G509985 NA non-coding downstream 10367 43150210 ~ 43150470 (+)
G509996 NA non-coding downstream 16785 43156628 ~ 43156859 (+)
G509997 NA non-coding downstream 17640 43157483 ~ 43157770 (+)
G509160 NA other upstream 569441 42567105 ~ 42570169 (+)
G508559 dph7 other upstream 1007670 42129225 ~ 42131940 (+)
G507768 LOC105030512 other upstream 1668202 41469551 ~ 41471408 (+)
fbxl17 fbxl17 other upstream 2280088 40568637 ~ 40886427 (+)
G506285 NA other upstream 2573181 40566067 ~ 40566429 (+)
G510416 NA other downstream 517625 43657468 ~ 43658493 (+)
G512192 LOC106584908 other downstream 2044596 45184439 ~ 45185869 (+)
LOC110526028 ccdc60 other downstream 2077884 45187119 ~ 45236944 (+)
G512912 NA other downstream 2495746 45635589 ~ 45636250 (+)
LOC110526042 LOC106584891 other downstream 3047157 46076084 ~ 46190292 (+)

Expression


G509968 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G509968 Expression in each Bioproject

Bar chart with 17 bars.
G509968 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network