G511647


Basic Information

Item Value
gene id G511647
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 44749641 ~ 44750048 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU580547
ATTTTATTCAGGTTTATTTTGTGTTTGAGTGATACAAAATGTTATGAAATGTTACATTATTGTGAAAAATGTCATTTGAGACGAATGGCAACAATTCATTTAAATAACCCTGTTAATTATTAATTCATCAGCCAAAAAAGTGAAATGGATGATAAAAAGCTGACCCATACATCGGCTACTGTGAAAGCCAACCACCAATAATTACACATTTTTTCACAGTTTCATAGGTAGTAAAATGTTCTCTTTAATATCAATCTTCCAACACCTAAAATGTGACAAGTTCTTCCATATCTGTATGTTCTAGCTGTAATGGATGTTCAACAATTTCTTCATCTTCATGGTCATCTGAAAAAGAGATGGGTTACAGATTTGGGTTTGAGCTGCAT

Function

NR:

description
V-set and immunoglobulin domain-containing protein 10-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU580547 True 386 lncRNA 0.32 2 44749641 44750048

Neighbor

gene id symbol gene type direction distance location
LOC110526020 NA coding upstream 9069 44730067 ~ 44740687 (+)
LOC110526013 LOC106585235 coding upstream 400854 44345482 ~ 44348787 (+)
LOC110526014 NA coding upstream 409852 44337537 ~ 44339789 (+)
LOC110526012 LOC106585234 coding upstream 440281 44295614 ~ 44309360 (+)
LOC110526009 LOC106585233 coding upstream 454403 44284852 ~ 44295238 (+)
LOC110526024 suds3 coding downstream 123337 44873385 ~ 44895982 (+)
LOC110526025 srrm4 coding downstream 311610 45061658 ~ 45152985 (+)
LOC110526027 hspb8 coding downstream 405933 45155981 ~ 45178825 (+)
LOC110526028 ccdc60 coding downstream 437071 45187119 ~ 45236944 (+)
si:dkey-174n20.1 LOC106584900 coding downstream 897686 45647734 ~ 45654067 (+)
G511577 NA non-coding upstream 94073 44655225 ~ 44655568 (+)
G511573 NA non-coding upstream 104193 44645224 ~ 44645448 (+)
G511564 NA non-coding upstream 125923 44623249 ~ 44623718 (+)
G511535 NA non-coding upstream 161120 44588241 ~ 44588521 (+)
G511781 NA non-coding downstream 270199 45020247 ~ 45045920 (+)
G512188 NA non-coding downstream 307663 45057711 ~ 45058035 (+)
G512277 NA non-coding downstream 457211 45207259 ~ 45207720 (+)
G512284 NA non-coding downstream 462734 45212782 ~ 45213075 (+)
G510416 NA other upstream 1091148 43657468 ~ 43658493 (+)
G509160 NA other upstream 2179472 42567105 ~ 42570169 (+)
G508559 dph7 other upstream 2617701 42129225 ~ 42131940 (+)
G507768 LOC105030512 other upstream 3278233 41469551 ~ 41471408 (+)
fbxl17 fbxl17 other upstream 3890119 40568637 ~ 40886427 (+)
G512192 LOC106584908 other downstream 434391 45184439 ~ 45185869 (+)
G512912 NA other downstream 885541 45635589 ~ 45636250 (+)
LOC110526042 LOC106584891 other downstream 1436952 46076084 ~ 46190292 (+)
G513501 NA other downstream 1609908 46359956 ~ 46360585 (+)

Expression


Co-expression Network