G513944



Basic Information


Item Value
gene id G513944
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 46170054 ~ 46170303 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU583032
CTATAACTCTGGACAGCGATCTACTCACCCATAGAGCTCTTCATCCTCTGGGCTGGGGCGTAGCAGAATCTTAGGAGTAATCTTTGCTGACGCTGGTAAACAAGAAACACACATACATGAACACATCTAAACAAATACTGATGGGTGAGTTCTCATCAATGACCACCCGTACTGGAAGATTACATACTCAATCAATGACAGGCTAGATAATGCCAGGCTGAAAAGCTGTAGACTAACACCTGGTTACGAA

Function


NR:

description
tight junction protein ZO-2-like isoform X2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU583032 True 250 lncRNA 0.44 1 46170054 46170303

Neighbor


gene id symbol gene type direction distance location
LOC110526039 NA coding downstream 174668 45973773 ~ 45995386 (-)
LOC110526038 LOC106584879 coding downstream 215303 45915772 ~ 45954751 (-)
LOC100136024 LOC100136024 coding downstream 262895 45904051 ~ 45907159 (-)
LOC110526037 LOC106584895 coding downstream 306813 45851230 ~ 45863241 (-)
LOC118965028 NA coding downstream 395126 45765669 ~ 45774928 (-)
apba1a apba1 coding upstream 92818 46263121 ~ 46360886 (-)
LOC110526044 LOC107699739 coding upstream 197398 46367701 ~ 46430607 (-)
rnf215 rnf215 coding upstream 291060 46461363 ~ 46471132 (-)
LOC110526055 samd3 coding upstream 806092 46971364 ~ 46980777 (-)
utp15 utp15 coding upstream 875190 47045493 ~ 47056805 (-)
G513943 NA non-coding downstream 526 46169316 ~ 46169528 (-)
G513942 NA non-coding downstream 1053 46168790 ~ 46169001 (-)
G513941 NA non-coding downstream 2068 46167782 ~ 46167986 (-)
G513940 NA non-coding downstream 3258 46166590 ~ 46166796 (-)
G513925 NA non-coding downstream 29999 46138158 ~ 46140055 (-)
G513945 NA non-coding upstream 373 46170676 ~ 46170969 (-)
G513947 NA non-coding upstream 968 46171271 ~ 46171612 (-)
G513949 LOC106584891 non-coding upstream 3429 46173732 ~ 46173952 (-)
G513950 NA non-coding upstream 4484 46174787 ~ 46175056 (-)
G513951 NA non-coding upstream 5463 46175766 ~ 46175965 (-)
znrf3 LOC106584905 other downstream 893667 45270568 ~ 45384850 (-)
nf2a nf2 other downstream 1958231 44209338 ~ 44272386 (-)
prodhb LOC100194675 other downstream 2221665 43940790 ~ 43955257 (-)
G510310 NA other downstream 2645946 43523714 ~ 43524108 (-)
G509952 NA other downstream 3044667 43124581 ~ 43125387 (-)
G514434 NA other upstream 740355 46910658 ~ 46910950 (-)
G514777 NA other upstream 845859 47016162 ~ 47016496 (-)
G515094 LOC106585477 other upstream 1804490 47974793 ~ 47976975 (-)

Expression


G513944 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.
End of interactive chart.

G513944 Expression in each Bioproject

Bar chart with 4 bars.
G513944 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 5.
End of interactive chart.

Co-expression Network