G514434



Basic Information


Item Value
gene id G514434
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 46910658 ~ 46910950 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU583552
gacagggaagatggttaaaattgatgggaagatggatggagccaaatacaggaccattctggaagaaaacctgatggagtctgcaaaagacctgggacggagatttgtcttccaacaagacaatgatccaaaacataaagcaaaatctacaatggaatggttcaaaaataaacatatccaggtgttagaatggccaagtcaaagtccagacctgaatccaatcgagaatctgtggaaagaactgaaaactgctgttcacaaatgctctccatccaacctcactgagctcgagc

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU583552 True 293 TUCP 0.42 1 46910658 46910950

Neighbor


gene id symbol gene type direction distance location
rnf215 rnf215 coding downstream 439526 46461363 ~ 46471132 (-)
LOC110526044 LOC107699739 coding downstream 480051 46367701 ~ 46430607 (-)
apba1a apba1 coding downstream 550676 46263121 ~ 46360886 (-)
LOC110526039 NA coding downstream 915272 45973773 ~ 45995386 (-)
LOC110526038 LOC106584879 coding downstream 955907 45915772 ~ 45954751 (-)
LOC110526055 samd3 coding upstream 65445 46971364 ~ 46980777 (-)
utp15 utp15 coding upstream 134543 47045493 ~ 47056805 (-)
LOC118965029 NA coding upstream 435884 47346834 ~ 47349012 (-)
LOC118965030 NA coding upstream 440761 47351711 ~ 47353889 (-)
LOC118964878 LOC106585477 coding upstream 596213 47507163 ~ 47511010 (-)
G514430 NA non-coding downstream 937 46909376 ~ 46909721 (-)
G514424 NA non-coding downstream 7075 46901544 ~ 46903583 (-)
G514363 NA non-coding downstream 108812 46801577 ~ 46801846 (-)
G514184 NA non-coding downstream 336422 46573241 ~ 46574236 (-)
G514134 NA non-coding downstream 360867 46487166 ~ 46549791 (-)
G514435 NA non-coding upstream 186 46911136 ~ 46911475 (-)
G514445 NA non-coding upstream 5355 46916305 ~ 46916540 (-)
G514737 NA non-coding upstream 13076 46924026 ~ 46924560 (-)
G514744 NA non-coding upstream 17049 46927999 ~ 46928331 (-)
G514747 NA non-coding upstream 18859 46929809 ~ 46930030 (-)
znrf3 LOC106584905 other downstream 1634271 45270568 ~ 45384850 (-)
nf2a nf2 other downstream 2698835 44209338 ~ 44272386 (-)
prodhb LOC100194675 other downstream 2962269 43940790 ~ 43955257 (-)
G514777 NA other upstream 105212 47016162 ~ 47016496 (-)
G515094 LOC106585477 other upstream 1063843 47974793 ~ 47976975 (-)
G515122 LOC106585477 other upstream 1353043 48263993 ~ 48264977 (-)
LOC110512142 LOC106585477 other upstream 1381896 48292846 ~ 48318495 (-)
G515139 LOC106585477 other upstream 1408797 48319747 ~ 48320588 (-)

Expression


G514434 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G514434 Expression in each Bioproject

Bar chart with 17 bars.
G514434 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network