G514435



Basic Information


Item Value
gene id G514435
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 46911136 ~ 46911475 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU583553
atgcaaaaagatttcccaagctttaaacatcccaaggagcactgtgcaagcgatgatattgaaatggaaggagtatcagaccactgcaaatctaccaagacctggccgtccctctaaacttttagctcatacaagaagaagactgatcagagatgcagccaagaggcccatgatcactctggatgaactgcagagatctacagctgaggtgggagactctgtccataggacaacaatcagtcgtatattgcacaaatctggcctttatggaagagtggcaagaagaaagccatttcttaaagatatccataaaaagtgttgtttaaagtctgccacaagc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU583553 True 340 lncRNA 0.43 1 46911136 46911475
Loading

Neighbor


gene id symbol gene type direction distance location
rnf215 rnf215 coding downstream 440004 46461363 ~ 46471132 (-)
LOC110526044 LOC107699739 coding downstream 480529 46367701 ~ 46430607 (-)
apba1a apba1 coding downstream 551154 46263121 ~ 46360886 (-)
LOC110526039 NA coding downstream 915750 45973773 ~ 45995386 (-)
LOC110526038 LOC106584879 coding downstream 956385 45915772 ~ 45954751 (-)
LOC110526055 samd3 coding upstream 64920 46971364 ~ 46980777 (-)
utp15 utp15 coding upstream 134018 47045493 ~ 47056805 (-)
LOC118965029 NA coding upstream 435359 47346834 ~ 47349012 (-)
LOC118965030 NA coding upstream 440236 47351711 ~ 47353889 (-)
LOC118964878 LOC106585477 coding upstream 595688 47507163 ~ 47511010 (-)
G514430 NA non-coding downstream 1415 46909376 ~ 46909721 (-)
G514424 NA non-coding downstream 7553 46901544 ~ 46903583 (-)
G514363 NA non-coding downstream 109290 46801577 ~ 46801846 (-)
G514184 NA non-coding downstream 336900 46573241 ~ 46574236 (-)
G514155 NA non-coding downstream 384056 46526008 ~ 46527080 (-)
G514445 NA non-coding upstream 4830 46916305 ~ 46916540 (-)
G514737 NA non-coding upstream 12551 46924026 ~ 46924560 (-)
G514744 NA non-coding upstream 16524 46927999 ~ 46928331 (-)
G514747 NA non-coding upstream 18334 46929809 ~ 46930030 (-)
G514766 NA non-coding upstream 45723 46957198 ~ 46993287 (-)
G514434 NA other downstream 186 46910658 ~ 46910950 (-)
znrf3 LOC106584905 other downstream 1634749 45270568 ~ 45384850 (-)
nf2a nf2 other downstream 2699313 44209338 ~ 44272386 (-)
G514777 NA other upstream 104687 47016162 ~ 47016496 (-)
G515094 LOC106585477 other upstream 1063318 47974793 ~ 47976975 (-)
G515122 LOC106585477 other upstream 1352518 48263993 ~ 48264977 (-)
LOC110512142 LOC106585477 other upstream 1381371 48292846 ~ 48318495 (-)
G515139 LOC106585477 other upstream 1408272 48319747 ~ 48320588 (-)

Expression


G514435 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G514435 Expression in each Bioproject

Bar chart with 19 bars.
G514435 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network