G514747



Basic Information


Item Value
gene id G514747
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 46929809 ~ 46930030 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU583918
tcagaaatacagtgtaggcattgttgtaaatgactagtgtagctggaaacggctgattttttaatgaaatatctacataggcgtacagaggcccattatcagcaaccatcactcctgtgttccaatgccacgatgtgttagctaatccaagataatcattttaaaaggctaattgatcattggaaaacccttttgcaattatgttagcacagctgaaaactg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU583918 True 222 lncRNA 0.38 1 46929809 46930030

Neighbor


gene id symbol gene type direction distance location
rnf215 rnf215 coding downstream 458677 46461363 ~ 46471132 (-)
LOC110526044 LOC107699739 coding downstream 499202 46367701 ~ 46430607 (-)
apba1a apba1 coding downstream 569827 46263121 ~ 46360886 (-)
LOC110526039 NA coding downstream 934423 45973773 ~ 45995386 (-)
LOC110526038 LOC106584879 coding downstream 975058 45915772 ~ 45954751 (-)
LOC110526055 samd3 coding upstream 46365 46971364 ~ 46980777 (-)
utp15 utp15 coding upstream 115463 47045493 ~ 47056805 (-)
LOC118965029 NA coding upstream 416804 47346834 ~ 47349012 (-)
LOC118965030 NA coding upstream 421681 47351711 ~ 47353889 (-)
LOC118964878 LOC106585477 coding upstream 577133 47507163 ~ 47511010 (-)
G514744 NA non-coding downstream 1478 46927999 ~ 46928331 (-)
G514737 NA non-coding downstream 5249 46924026 ~ 46924560 (-)
G514445 NA non-coding downstream 13269 46916305 ~ 46916540 (-)
G514435 NA non-coding downstream 18334 46911136 ~ 46911475 (-)
G514430 NA non-coding downstream 20088 46909376 ~ 46909721 (-)
G514766 NA non-coding upstream 27168 46957198 ~ 46993287 (-)
G514769 NA non-coding upstream 74080 47004110 ~ 47004357 (-)
G514776 NA non-coding upstream 80731 47010761 ~ 47011827 (-)
G514740 NA non-coding upstream 103800 47033830 ~ 47035938 (-)
G514434 NA other downstream 18859 46910658 ~ 46910950 (-)
znrf3 LOC106584905 other downstream 1653422 45270568 ~ 45384850 (-)
nf2a nf2 other downstream 2717986 44209338 ~ 44272386 (-)
G514777 NA other upstream 86132 47016162 ~ 47016496 (-)
G515094 LOC106585477 other upstream 1044763 47974793 ~ 47976975 (-)
G515122 LOC106585477 other upstream 1333963 48263993 ~ 48264977 (-)
LOC110512142 LOC106585477 other upstream 1362816 48292846 ~ 48318495 (-)
G515139 LOC106585477 other upstream 1389717 48319747 ~ 48320588 (-)

Expression


G514747 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G514747 Expression in each Bioproject

Bar chart with 17 bars.
G514747 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network