G514777



Basic Information


Item Value
gene id G514777
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 47016162 ~ 47016496 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU583955
GCTAAGTATGGACAATGCTTCAGAAAGGCTATGCATAAAACAGAAAAATGGCACCAAACTTAGAATACGACACAAAGCTAAAAAGGAACCTAGTCAGGAAGAGATATACCTTAAATATTTAGTGTTATATCTTCACACAGGCAATAAATCATCATGGGATGATAGAGTGCTAGGAGGAAACAATGGTATAATCCTCCCCTATACAAAACGAAGAACATACAGGTATCCAGGTTACACGTCAGGGCCTTTGGATAGATTCTTTATGTTTGAGTATGGGCAAGTAAACAATAGGATACCAATGGCTCAAACCCAGGATAAAAACCCCATGTATTACA

Function


NR:

description
uncharacterized protein LOC110526051

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU583955 True 335 TUCP 0.38 1 47016162 47016496

Neighbor


gene id symbol gene type direction distance location
LOC110526055 samd3 coding downstream 35385 46971364 ~ 46980777 (-)
rnf215 rnf215 coding downstream 545030 46461363 ~ 46471132 (-)
LOC110526044 LOC107699739 coding downstream 585555 46367701 ~ 46430607 (-)
apba1a apba1 coding downstream 656180 46263121 ~ 46360886 (-)
LOC110526039 NA coding downstream 1020776 45973773 ~ 45995386 (-)
utp15 utp15 coding upstream 28997 47045493 ~ 47056805 (-)
LOC118965029 NA coding upstream 330338 47346834 ~ 47349012 (-)
LOC118965030 NA coding upstream 335215 47351711 ~ 47353889 (-)
LOC118964878 LOC106585477 coding upstream 490667 47507163 ~ 47511010 (-)
LOC118964883 LOC106585477 coding upstream 517320 47533816 ~ 47534526 (-)
G514776 NA non-coding downstream 4335 47010761 ~ 47011827 (-)
G514769 NA non-coding downstream 11805 47004110 ~ 47004357 (-)
G514766 NA non-coding downstream 22875 46957198 ~ 46993287 (-)
G514747 NA non-coding downstream 86132 46929809 ~ 46930030 (-)
G514740 NA non-coding upstream 17334 47033830 ~ 47035938 (-)
G514741 NA non-coding upstream 26471 47042967 ~ 47043364 (-)
G514787 NA non-coding upstream 44413 47060909 ~ 47061207 (-)
G514788 NA non-coding upstream 46712 47063208 ~ 47070086 (-)
G514804 NA non-coding upstream 71979 47088475 ~ 47088734 (-)
G514434 NA other downstream 105212 46910658 ~ 46910950 (-)
znrf3 LOC106584905 other downstream 1739775 45270568 ~ 45384850 (-)
nf2a nf2 other downstream 2804339 44209338 ~ 44272386 (-)
G515094 LOC106585477 other upstream 958297 47974793 ~ 47976975 (-)
G515122 LOC106585477 other upstream 1247497 48263993 ~ 48264977 (-)
LOC110512142 LOC106585477 other upstream 1276350 48292846 ~ 48318495 (-)
G515139 LOC106585477 other upstream 1303251 48319747 ~ 48320588 (-)
LOC118964892 LOC106585477 other upstream 1359450 48375946 ~ 48387076 (-)

Expression


G514777 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G514777 Expression in each Bioproject

Bar chart with 12 bars.
G514777 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 16.
End of interactive chart.

Co-expression Network