G514916



Basic Information


Item Value
gene id G514916
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 47257205 ~ 47257452 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU584102
cttagaaatatttaacctccacacattaacaagtccaatagctcaaatgaaagataaacatcttgttcatctagccagcaagtcagatttctaaaatgttttacggcgaaaacatagcacatatatatgtcaaaccaccaccagacacagctcatttgaatagccaaaacatgcaatcaacaaacgcaggattaaaaaataaatcgttcactaaccttttgaaaatcttcatcagatgacagtaatag

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU584102 True 248 lncRNA 0.34 1 47257205 47257452

Neighbor


gene id symbol gene type direction distance location
utp15 utp15 coding downstream 200400 47045493 ~ 47056805 (-)
LOC110526055 samd3 coding downstream 276428 46971364 ~ 46980777 (-)
rnf215 rnf215 coding downstream 786073 46461363 ~ 46471132 (-)
LOC110526044 LOC107699739 coding downstream 826598 46367701 ~ 46430607 (-)
apba1a apba1 coding downstream 897223 46263121 ~ 46360886 (-)
LOC118965029 NA coding upstream 89382 47346834 ~ 47349012 (-)
LOC118965030 NA coding upstream 94259 47351711 ~ 47353889 (-)
LOC118964878 LOC106585477 coding upstream 249711 47507163 ~ 47511010 (-)
LOC118964883 LOC106585477 coding upstream 276364 47533816 ~ 47534526 (-)
LOC118964884 LOC106585477 coding upstream 408362 47665814 ~ 47667571 (-)
G514902 NA non-coding downstream 22343 47233817 ~ 47234862 (-)
G514812 NA non-coding downstream 159723 47097187 ~ 47097482 (-)
G514804 NA non-coding downstream 168471 47088475 ~ 47088734 (-)
G514788 NA non-coding downstream 187119 47063208 ~ 47070086 (-)
G514787 NA non-coding downstream 195998 47060909 ~ 47061207 (-)
G514929 NA non-coding upstream 17049 47274501 ~ 47274711 (-)
G514931 NA non-coding upstream 20177 47277629 ~ 47277870 (-)
G514935 NA non-coding upstream 22851 47280303 ~ 47280533 (-)
G514936 NA non-coding upstream 23266 47280718 ~ 47280949 (-)
G514937 NA non-coding upstream 24113 47281565 ~ 47284419 (-)
G514777 NA other downstream 240709 47016162 ~ 47016496 (-)
G514434 NA other downstream 346255 46910658 ~ 46910950 (-)
znrf3 LOC106584905 other downstream 1980818 45270568 ~ 45384850 (-)
G515094 LOC106585477 other upstream 717341 47974793 ~ 47976975 (-)
G515122 LOC106585477 other upstream 1006541 48263993 ~ 48264977 (-)
LOC110512142 LOC106585477 other upstream 1035394 48292846 ~ 48318495 (-)
G515139 LOC106585477 other upstream 1062295 48319747 ~ 48320588 (-)
LOC118964892 LOC106585477 other upstream 1118494 48375946 ~ 48387076 (-)

Expression


G514916 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G514916 Expression in each Bioproject

Bar chart with 11 bars.
G514916 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network