G514675



Basic Information


Item Value
gene id G514675
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 47330427 ~ 47339327 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU583819
actttactcaaaccagtgaatatcacttattataaatgagatcattaactatcagctcttggaatatccagggcctatactcttcacattttggttataaaacaacaaatccagaattgattaaaaacatcaagggacaggacatcataatcctactggaaacatggtgtcgtggagacatagatactcagtgtccctcaggctatagagaaagtttactaccatcaatcaaacataaaaatgttaaacggggccgagactcaggtggaatcatcatttggcataagcaggacttagcactgaatgaaatgaaaaaaggtaccactcacatttgactaaaacttaacaaaggtacaatctattgtgacaatgatgtatacatatgtgcagcttatgctcctccttcagattcatcatattatgatgatcagttttttgacaatctccagacagaaatcattacatttcaggcacagggtaaagtgcttctttgtggagatttcaatgcaagaacaggttctgagcctgactacactgatgcgggaggtaaccaccacatatttggacacacctctttgtac

Function


NR:

description
PREDICTED: uncharacterized protein LOC109105496

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU583819 True 581 lncRNA 0.38 2 47330427 47339327
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110526052 hic2 coding upstream 112993 47150900 ~ 47217434 (+)
si:dkey-88e18.2 il12b coding upstream 211416 47110812 ~ 47119011 (+)
LOC110526907 NA coding upstream 326075 46993596 ~ 47004352 (+)
LOC110526054 NA coding upstream 352299 46935543 ~ 46978128 (+)
LOC118964876 NA coding upstream 395150 46931084 ~ 46935277 (+)
LOC118964877 NA coding downstream 56040 47395367 ~ 47398426 (+)
LOC110526909 LOC106585521 coding downstream 81914 47421241 ~ 47424219 (+)
LOC110526910 LOC106585521 coding downstream 111518 47450664 ~ 47494972 (+)
LOC118964881 LOC106585521 coding downstream 174305 47425001 ~ 47519480 (+)
LOC118964880 LOC106585521 coding downstream 199994 47539321 ~ 47543002 (+)
G514656 NA non-coding upstream 35351 47294875 ~ 47295076 (+)
G514632 NA non-coding upstream 46001 47281500 ~ 47284426 (+)
G514641 NA non-coding upstream 61096 47269043 ~ 47269331 (+)
G514639 NA non-coding upstream 62506 47267619 ~ 47267921 (+)
G514628 NA non-coding upstream 74267 47255681 ~ 47256160 (+)
G514684 NA non-coding downstream 8134 47347461 ~ 47352548 (+)
G514685 NA non-coding downstream 8310 47347637 ~ 47353169 (+)
G514709 NA non-coding downstream 82976 47422303 ~ 47422634 (+)
G514718 NA non-coding downstream 98011 47437338 ~ 47437660 (+)
G514662 LOC106597055 other upstream 1183 47303183 ~ 47329244 (+)
G514665 NA other upstream 10377 47306438 ~ 47320050 (+)
G514499 NA other upstream 307335 47022294 ~ 47023092 (+)
G514464 NA other upstream 402713 46926842 ~ 46927714 (+)
G513745 NA other upstream 429304 46900561 ~ 46901123 (+)
G515069 NA other downstream 610679 47950006 ~ 47952254 (+)
G515189 LOC100135962 other downstream 1212292 48532377 ~ 48587888 (+)
LOC110526072 LOC106587002 other downstream 1609290 48948617 ~ 49037542 (+)
edf1 edf1 other downstream 1844546 49183291 ~ 49187334 (+)

Expression


G514675 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G514675 Expression in each Bioproject

Bar chart with 19 bars.
G514675 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network