G515060



Basic Information


Item Value
gene id G515060
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 47721224 ~ 47721489 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU584259
atgtttcaatgggcaggtaccatcacgaatttgtcatgctcaaaattttttagatgtatttttttttgtttccttactttttcaaagtcactgtgcatttggaatatgttttaatgggccgataccatcacgaatttgtttatcgaatttgtttatgtttccttactttttcaaagtcactgtgcatttgcaatatgtttcaatgggcaggtaccatcacgaatttgtcatgctcaaaattttttagatgtatttttttttgtttc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU584259 True 266 lncRNA 0.32 1 47721224 47721489
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118964882 NA coding downstream 31972 47688651 ~ 47689252 (-)
LOC118964884 LOC106585477 coding downstream 54700 47665814 ~ 47667571 (-)
LOC118964883 LOC106585477 coding downstream 186698 47533816 ~ 47534526 (-)
LOC118964878 LOC106585477 coding downstream 210214 47507163 ~ 47511010 (-)
LOC118965030 NA coding downstream 367335 47351711 ~ 47353889 (-)
LOC118964890 NA coding upstream 212049 47933538 ~ 47934317 (-)
LOC110513487 LOC106585477 coding upstream 226826 47948315 ~ 47975648 (-)
LOC110511762 NA coding upstream 254471 47943033 ~ 47985651 (-)
LOC118965031 LOC106585477 coding upstream 294815 48016304 ~ 48017854 (-)
LOC110512142 LOC106585477 coding upstream 576028 48292846 ~ 48318495 (-)
G515058 NA non-coding downstream 4376 47716037 ~ 47716848 (-)
G515049 NA non-coding downstream 18695 47702308 ~ 47702529 (-)
G515047 NA non-coding downstream 26932 47694061 ~ 47694292 (-)
G515046 NA non-coding downstream 31161 47689354 ~ 47690063 (-)
G515045 NA non-coding downstream 44115 47676707 ~ 47677109 (-)
G515064 NA non-coding upstream 4544 47726033 ~ 47726250 (-)
G515067 NA non-coding upstream 221260 47942749 ~ 47943000 (-)
G515099 NA non-coding upstream 265645 47987134 ~ 47987356 (-)
G515103 NA non-coding upstream 273000 47994489 ~ 47994807 (-)
G514777 NA other downstream 704728 47016162 ~ 47016496 (-)
G514434 NA other downstream 810274 46910658 ~ 46910950 (-)
LOC110526044 LOC107699739 other downstream 1290864 46367701 ~ 46430607 (-)
apba1a apba1 other downstream 1360338 46263121 ~ 46360886 (-)
znrf3 LOC106584905 other downstream 2444837 45270568 ~ 45384850 (-)
G515094 LOC106585477 other upstream 253304 47974793 ~ 47976975 (-)
G515122 LOC106585477 other upstream 542504 48263993 ~ 48264977 (-)
G515139 LOC106585477 other upstream 598258 48319747 ~ 48320588 (-)
LOC118964892 LOC106585477 other upstream 654457 48375946 ~ 48387076 (-)

Expression


G515060 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G515060 Expression in each Bioproject

Bar chart with 6 bars.
G515060 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network