G516293



Basic Information


Item Value
gene id G516293
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 49222387 ~ 49222646 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU585650
atccaattgttgtagtagctactatcttgtctcatcgctacaactcccgtacgggctcgggagagacgaaggttgaaagtcatgcgtcctccgatacacaacccaaccaagccgcactgcttcttaacacagcacgcatccaacccggaagccagccgcaccaatgtgccggaggaaacaccgtgcacctggccaccttggttagcgcacactgcgcccagtccgccacaggagtcgctggtgcgcgatgagacaaggac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU585650 True 260 lncRNA 0.57 1 49222387 49222646
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110526068 LOC106586971 coding downstream 2206 49195188 ~ 49220181 (-)
surf4l LOC106587003 coding downstream 277511 48899344 ~ 48944876 (-)
LOC110526076 LOC106587004 coding downstream 472015 48672475 ~ 48750372 (-)
prdm12b LOC106587007 coding downstream 591999 48625747 ~ 48630388 (-)
c5 c5 coding downstream 596952 48551620 ~ 48625435 (-)
serpind1 LOC106603687 coding upstream 10938 49233584 ~ 49240694 (-)
LOC118964899 LOC106585521 coding upstream 91579 49314225 ~ 49316393 (-)
LOC110512258 LOC106585521 coding upstream 93633 49316279 ~ 49320412 (-)
LOC110512256 LOC106585521 coding upstream 124212 49346858 ~ 49349193 (-)
LOC118936342 LOC106585521 coding upstream 157070 49379716 ~ 49385907 (-)
G516257 NA non-coding downstream 35063 49183879 ~ 49187324 (-)
G516275 NA non-coding downstream 47070 49175051 ~ 49175317 (-)
G516183 NA non-coding downstream 159127 49045784 ~ 49063260 (-)
G516182 NA non-coding downstream 200605 49021551 ~ 49021782 (-)
G516181 NA non-coding downstream 200932 49021180 ~ 49021455 (-)
G516298 NA non-coding upstream 5418 49228064 ~ 49229080 (-)
G516299 NA non-coding upstream 9876 49232522 ~ 49233050 (-)
G516300 NA non-coding upstream 10497 49233143 ~ 49233521 (-)
G516347 NA non-coding upstream 76864 49299510 ~ 49324004 (-)
G516304 NA non-coding upstream 77079 49299725 ~ 49342499 (-)
LOC118964892 LOC106585477 other downstream 842081 48375946 ~ 48387076 (-)
G515139 LOC106585477 other downstream 901799 48319747 ~ 48320588 (-)
LOC110512142 LOC106585477 other downstream 903980 48292846 ~ 48318495 (-)
G515122 LOC106585477 other downstream 957410 48263993 ~ 48264977 (-)
G516320 LOC106585521 other upstream 312569 49535215 ~ 49536285 (-)
LOC110515945 LOC106585521 other upstream 400403 49622196 ~ 49624916 (-)

Expression


G516293 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G516293 Expression in each Bioproject

Bar chart with 20 bars.
G516293 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network