G516364



Basic Information


Item Value
gene id G516364
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 49367999 ~ 49371049 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU585751
atttttttcccattcctccttgcaaaacagctcgagctcagtgaggttggatggagagcatttgtgaacagcagttttcagttctttacacagattctcgattggactcaggtctggactttgacttggccattctaacacctggatatgtttattttattccattgtagattttgctttatgttttggatcattgtcttgttggaagacaaatctccgtcccagtctcaggtcttttgcagactccatcgggttttcttccagaatggtcctgtatttggctccatccatcttcccatcaattttaaccatcttccctgtccctgctgaagaaaagcaggcccaaaccatgatgctgccaccaccatgtttgacagtggggatggtgtgttcagctgtgttgcttttacgccaaacataactttttggcaacaatgcaaa

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU585751 True 441 lncRNA 0.43 2 49367999 49371049
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110512256 LOC106585521 coding downstream 18806 49346858 ~ 49349193 (-)
LOC110512258 LOC106585521 coding downstream 47641 49316279 ~ 49320412 (-)
LOC118964899 LOC106585521 coding downstream 51606 49314225 ~ 49316393 (-)
serpind1 LOC106603687 coding downstream 127305 49233584 ~ 49240694 (-)
LOC110526068 LOC106586971 coding downstream 147818 49195188 ~ 49220181 (-)
LOC118936342 LOC106585521 coding upstream 8667 49379716 ~ 49385907 (-)
LOC118964902 LOC106585521 coding upstream 51380 49422429 ~ 49423820 (-)
LOC118964901 LOC106585521 coding upstream 56007 49427056 ~ 49432111 (-)
LOC118964900 LOC106585521 coding upstream 94861 49465910 ~ 49469267 (-)
LOC118964904 LOC106585521 coding upstream 125246 49496295 ~ 49499652 (-)
G516304 NA non-coding downstream 25500 49299725 ~ 49342499 (-)
G516347 NA non-coding downstream 43995 49299510 ~ 49324004 (-)
G516300 NA non-coding downstream 134478 49233143 ~ 49233521 (-)
G516299 NA non-coding downstream 134949 49232522 ~ 49233050 (-)
G516298 NA non-coding downstream 138919 49228064 ~ 49229080 (-)
G516369 NA non-coding upstream 30792 49401841 ~ 49419385 (-)
G516384 NA non-coding upstream 92894 49463943 ~ 49494964 (-)
G516386 NA non-coding upstream 100382 49471431 ~ 49504382 (-)
G516394 NA non-coding upstream 156822 49527871 ~ 49542101 (-)
prdm12b LOC106587007 other downstream 737694 48625747 ~ 48630388 (-)
LOC118964892 LOC106585477 other downstream 987693 48375946 ~ 48387076 (-)
G515139 LOC106585477 other downstream 1047411 48319747 ~ 48320588 (-)
G516320 LOC106585521 other upstream 164166 49535215 ~ 49536285 (-)
LOC110515945 LOC106585521 other upstream 252000 49622196 ~ 49624916 (-)
G517777 LOC106587028 other upstream 1274314 50636549 ~ 50740638 (-)
G517877 NA other upstream 1540765 50911814 ~ 50922098 (-)

Expression


G516364 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G516364 Expression in each Bioproject

Bar chart with 19 bars.
G516364 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network