G516745



Basic Information


Item Value
gene id G516745
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 50092075 ~ 50092450 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU586176
ctttaattatatgagctctatcacaaccctgtgactctcagatcaattcagtgtctatcaatgaattctctgagagtcccttacacattgcaactgagatcctttaatagcaaaagacacacatagccagacagcataggcataatttatcgttcagctttgtctcctaaactatgctttcttctcaaactcagaaccataaacaaatcctccatatcaacagccatatatcaaatccatcctatcttgacaagatcacagagacacactgactggcacacatacattgtggagccaagagatacacgcttgacctctcccctctctccggcccaagcaacttagtcttgacatagaacaggtactgcaaccccgc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU586176 True 376 lncRNA 0.42 1 50092075 50092450
Loading

Neighbor


gene id symbol gene type direction distance location
rsph14 rsph14 coding upstream 5116 50072326 ~ 50086959 (+)
kazald3 LOC106587018 coding upstream 37594 50051204 ~ 50054481 (+)
grin1b LOC106587016 coding upstream 91059 49948638 ~ 50001016 (+)
spaca9 NA coding upstream 194711 49895848 ~ 49897364 (+)
barhl1a barhl1 coding upstream 338815 49748788 ~ 49753260 (+)
LOC110526093 dmtn coding downstream 14342 50106792 ~ 50208464 (+)
si:dkey-220o5.5 LOC106587021 coding downstream 105892 50198342 ~ 50299370 (+)
fam160b2 LOC106587022 coding downstream 207632 50300082 ~ 50312773 (+)
adam9 adam9 coding downstream 247585 50340035 ~ 50417982 (+)
ogdha LOC106587025 coding downstream 351066 50443516 ~ 50513889 (+)
G516744 NA non-coding upstream 490 50091167 ~ 50091585 (+)
G516734 NA non-coding upstream 3067 50088684 ~ 50089008 (+)
G516725 NA non-coding upstream 42052 50049711 ~ 50050023 (+)
G516700 NA non-coding upstream 66299 50025517 ~ 50025776 (+)
G516696 NA non-coding upstream 78263 50013611 ~ 50013812 (+)
G516748 NA non-coding downstream 3758 50096208 ~ 50096449 (+)
G516751 NA non-coding downstream 9382 50101832 ~ 50102060 (+)
G516918 NA non-coding downstream 291556 50384006 ~ 50385057 (+)
G516933 NA non-coding downstream 341282 50433732 ~ 50433997 (+)
LOC118964898 LOC106585477 other upstream 704863 49347319 ~ 49387212 (+)
G516011 NA other upstream 784935 49305125 ~ 49307140 (+)
LOC110526066 LOC106584148 other upstream 845622 49233579 ~ 49260632 (+)
edf1 edf1 other upstream 904752 49183291 ~ 49187334 (+)
LOC118964907 NA other downstream 627951 50719208 ~ 50743120 (+)
LOC110526128 NA other downstream 819378 50911697 ~ 50922106 (+)
LOC110493840 LOC106605670 other downstream 2186043 52277694 ~ 52279409 (+)
G519603 NA other downstream 2559490 52651940 ~ 52655297 (+)
G521552 prmt3 other downstream 3833492 53925942 ~ 53955130 (+)

Expression


G516745 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G516745 Expression in each Bioproject

Bar chart with 17 bars.
G516745 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network