G519379



Basic Information


Item Value
gene id G519379
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 52207796 ~ 52208990 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU589049
gactgaatttttttcccattcctccttgcaaaacagctcaagctcagtgaggttggatggaaagcatttgtgaacagcagttttcagttctttccacagattctcgattggattcaggtctggactttgacttggccattctaacacctggatatgtttatttttgaaccattccattgtagattttgctttatgttttggatcattgtcttgttggaagacaaatctccgtcccagtctcaggtcttttgcagactccatcaggttttcttccagaatggtcctgtatttggctccatccatcttcccatcagttttaaccatcttccctgtccctgctgaagaaaagcaggcccaaaccatgatgctgccaccaccatgtttgacagtggggatggtgtgttcagctgtgttgcttttacgccaaacataacgttttgtattgttgccaaaaagttcaattttggtttcatctgaccagagcaccttcttccacatgtttggtgtgtctcccaggtggcttgtggcaaactttaaatgacactttttatggatatctttaagaaatggctttcttcttgccactcttccataaaggccagatttgtgcaatatatgactgattgttgtcctatggacagagtctcccacctcagctgtagatctctgcagttcatccagagtgatcatgggcctcttggctgcatctctgatcagtcttctccttgtatgagctgaaagtttagagggacggccaggtcttggtagatttgcagtggtctgatactccttccatttcaatattatcacttgcacagtgctccttgggatgtttaaagcttgggaaatctttttgtatccaaatccagctttaaacttcttcacaacagtatctcggacctgcctggtgtgttccttgttcttcatgatgctctctgcgcttttaacggacctctgagactatcacagtacaggtgcatttatacggagacttgattacacacaggtggattgtatttatcatcattagtcatttaggtcaacattggatcattcagagatcctcactgaacttctggagagagtttgctgcactgaaagtaaaggggctgaataattttgcacgcccaatttttcagtttttgatgtgttaaaaaagtttgaaatatccaataaatgtagttccacttcatga

Function


NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU589049 True 1195 lncRNA 0.42 1 52207796 52208990
Loading

Neighbor


gene id symbol gene type direction distance location
homer1b homer1 coding upstream 200921 51883283 ~ 52006875 (+)
LOC118964909 NA coding upstream 489565 51712790 ~ 51718231 (+)
LOC110526137 cep120 coding upstream 982532 51159434 ~ 51225264 (+)
znf608 znf608 coding upstream 1079652 51113986 ~ 51128144 (+)
LOC110526132 LOC106587036 coding upstream 1190668 50991573 ~ 51017128 (+)
LOC110493840 LOC106605670 coding downstream 68704 52277694 ~ 52279409 (+)
otpb LOC106587051 coding downstream 176152 52385142 ~ 52390468 (+)
mapk8ip1b LOC106587053 coding downstream 315366 52524356 ~ 52645645 (+)
LOC110502468 LOC106605670 coding downstream 346015 52555005 ~ 52558912 (+)
LOC118965081 NA coding downstream 857037 53066027 ~ 53067743 (+)
G519376 NA non-coding upstream 1476 52206117 ~ 52206320 (+)
G519374 NA non-coding upstream 1792 52205779 ~ 52206004 (+)
G519306 NA non-coding upstream 56561 52151025 ~ 52151235 (+)
G519118 NA non-coding upstream 176404 52031161 ~ 52031392 (+)
G519110 NA non-coding upstream 183709 52023748 ~ 52024087 (+)
G519388 NA non-coding downstream 7997 52216987 ~ 52217308 (+)
G519564 NA non-coding downstream 255059 52464049 ~ 52466190 (+)
G519602 NA non-coding downstream 439367 52648357 ~ 52649692 (+)
G519675 NA non-coding downstream 447214 52656204 ~ 52656459 (+)
G519685 LOC106587054 non-coding downstream 461435 52670425 ~ 52674545 (+)
LOC110526128 NA other upstream 1285699 50911697 ~ 50922106 (+)
LOC118964907 NA other upstream 1472560 50719208 ~ 50743120 (+)
barhl1a barhl1 other upstream 2456047 49748788 ~ 49753260 (+)
LOC118964898 LOC106585477 other upstream 2820584 49347319 ~ 49387212 (+)
G516011 NA other upstream 2900656 49305125 ~ 49307140 (+)
G519603 NA other downstream 442950 52651940 ~ 52655297 (+)
G521552 prmt3 other downstream 1716952 53925942 ~ 53955130 (+)
G521914 NA other downstream 2060935 54269925 ~ 54270259 (+)
LOC110526161 LOC106587065 other downstream 2670709 54793125 ~ 54954478 (+)

Expression


G519379 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G519379 Expression in each Bioproject

Bar chart with 20 bars.
G519379 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network