G526016



Basic Information


Item Value
gene id G526016
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 57146898 ~ 57147224 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU596120
cccacaatgccctccaacgaaccatcaaacaagcaaagtgtcaatacaggaataagattgaatcaaactacaccggctctgacgctcgtcagatgtggcagggcttgcaaactattagactacaaagggaagcacagccgagagctgcccagtgacacgagcataccagacaagctaaatgacttctatgctcgcttcgaggcaagtaacactgaaacatgcatgagagcatcagctgttcctgacgactgtgtgatcacgctctccgcagccgatgtgagtaagacatttacacaggtcaacattcacaaggctgcagggccagac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU596120 True 327 TUCP 0.50 1 57146898 57147224

Neighbor


gene id symbol gene type direction distance location
LOC110526194 NA coding downstream 54823 57090363 ~ 57092075 (-)
LOC118965083 NA coding downstream 68538 57076714 ~ 57078360 (-)
LOC110526193 acp2 coding downstream 76712 57049525 ~ 57070186 (-)
LOC110526192 LOC106587102 coding downstream 122743 56990537 ~ 57024155 (-)
LOC110526931 NA coding downstream 159669 56985983 ~ 56987229 (-)
LOC110526198 LOC106587109 coding upstream 133375 57280599 ~ 57293457 (-)
LOC110526199 LOC106587110 coding upstream 153576 57300800 ~ 57425432 (-)
creb3l1 LOC106587112 coding upstream 282386 57429610 ~ 57457907 (-)
LOC118964911 NA coding upstream 381008 57528232 ~ 57529213 (-)
zgc:110699 LOC106587114 coding upstream 401130 57548354 ~ 57555827 (-)
G526013 NA non-coding downstream 3316 57143304 ~ 57143582 (-)
G526012 NA non-coding downstream 4620 57142009 ~ 57142278 (-)
G526011 NA non-coding downstream 5229 57141453 ~ 57141669 (-)
G526008 NA non-coding downstream 9617 57136963 ~ 57137281 (-)
G526006 NA non-coding downstream 10952 57135661 ~ 57135946 (-)
G526022 NA non-coding upstream 12256 57159480 ~ 57159838 (-)
G526024 NA non-coding upstream 15786 57163010 ~ 57163236 (-)
G526029 NA non-coding upstream 22541 57169765 ~ 57169994 (-)
G526031 NA non-coding upstream 25028 57172252 ~ 57172498 (-)
G526032 NA non-coding upstream 25444 57172668 ~ 57172945 (-)
LOC110526187 LOC106587097 other downstream 200573 56893209 ~ 56947117 (-)
G525008 LOC106561927 other downstream 844247 56167431 ~ 56302651 (-)
G524834 NA other downstream 1177226 55968340 ~ 55969672 (-)
G521468 NA other downstream 3334860 53811713 ~ 53812038 (-)
G521418 NA other downstream 3385013 53760233 ~ 53761885 (-)
ccnd1 LOC106587137 other upstream 808184 57955388 ~ 57962808 (-)
G526752 NA other upstream 834243 57981467 ~ 57981791 (-)
G526784 dhcr7 other upstream 1004626 58151850 ~ 58154916 (-)
G526903 NA other upstream 1111328 58258552 ~ 58258976 (-)
G527449 NA other upstream 1630558 58777782 ~ 58778467 (-)

Expression


G526016 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G526016 Expression in each Bioproject

Bar chart with 20 bars.
G526016 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network