G532846



Basic Information


Item Value
gene id G532846
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 62959178 ~ 62959401 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU603437
gtatgtgtgtgcgtaagttgtgtgtatgtgtgtgtgtatgtttgtgtgtatgtgtgtgcgtatgtttgtgtgtatgtgtgtgcgtatgtttgtgtgtatgtgtgtgcgtatgtttgtgtgtatgtgtgtgcgtatgtttgtgtgtatgtgtgggcgtatgtttgtgtgtatgtgtgggcgtatgtttgtgtgtatgtgtgggcgtatgtttgtgtgtatgtgtg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU603437 True 224 lncRNA 0.43 1 62959178 62959401
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110526305 LOC106587257 coding downstream 210797 62742187 ~ 62748381 (-)
LOC110526304 NA coding downstream 312003 62623295 ~ 62647175 (-)
LOC110526302 LOC106562167 coding downstream 392964 62500665 ~ 62566214 (-)
pabpn1l LOC106587263 coding downstream 464374 62491676 ~ 62494804 (-)
LOC110526298 galns coding downstream 469031 62467186 ~ 62490147 (-)
LOC110526309 dpep1 coding upstream 6814 62966215 ~ 62974919 (-)
LOC110526310 LOC106587159 coding upstream 26085 62985486 ~ 62991995 (-)
LOC118936659 LOC106581595 coding upstream 73528 63032929 ~ 63035742 (-)
LOC118964917 NA coding upstream 122818 63082219 ~ 63084974 (-)
LOC118964916 LOC106581595 coding upstream 127661 63087062 ~ 63089877 (-)
G532833 NA non-coding downstream 12028 62944109 ~ 62947150 (-)
G532762 NA non-coding downstream 69507 62889144 ~ 62889671 (-)
G532779 NA non-coding downstream 99608 62857752 ~ 62859570 (-)
G532765 NA non-coding downstream 137665 62820759 ~ 62821513 (-)
G532706 NA non-coding downstream 241081 62717897 ~ 62718097 (-)
G532847 NA non-coding upstream 1299 62960700 ~ 62961839 (-)
G532848 LOC106562160 non-coding upstream 2636 62962037 ~ 62966037 (-)
G532855 NA non-coding upstream 19088 62978489 ~ 62978753 (-)
G532875 NA non-coding upstream 38306 62997707 ~ 62998330 (-)
G532766 NA other downstream 104171 62822905 ~ 62855007 (-)
G532763 NA other downstream 106361 62851696 ~ 62852817 (-)
znf536 LOC106562015 other downstream 3262215 59507092 ~ 59698393 (-)
G527449 NA other downstream 4180711 58777782 ~ 58778467 (-)
igdcc3 LOC106562146 other upstream 864498 63823887 ~ 63944930 (-)
G534201 NA other upstream 1539052 64498453 ~ 64499614 (-)
G534349 NA other upstream 1619397 64578798 ~ 64614796 (-)
G534603 NA other upstream 1896094 64855495 ~ 64895099 (-)

Expression


G532846 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G532846 Expression in each Bioproject

Bar chart with 13 bars.
G532846 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network