G535619



Basic Information


Item Value
gene id G535619
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 65305399 ~ 65307541 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU606463
gagttagaggatggagtggtggtgttacggagagttagaggatggagtggtggtgttaggaagagttagaggatggagtggtggtgttagggagagttagaggatggagtggtggtattagggagagttagaggatggagtggggtgttagggagagttagaggatggagtggtggtgttagggagagttagaggatggagtggtggtgttagggacagttagaggatggagtggtggtgttaggaagagttagaggatggagtggtggtgttacggagagttagaggatggagtggtggtgttaggaagagttagaggatggagtggtggtgttagggagagttagaggatggagtggtggtattagggagagttagaggatggagtggggtgttagggagagttagaggatggagtggtggtgttagggagagttagaggttggagtggtggtgttagggagagttagaggatagagtggtggtgttacggagagttagaggatggagtagtggtgttagggagagttagaggatggagtggtggtgttagggagagttagaggttggagtggtggtgttagggagagttagaggatagagtggtggtgttacggagagttagaggatggagtggtggtgttagggagagttagaggatggagtggtggtgttagggagagttagaggttggagtggtggtgttagggagagttagaggatagagtggtggtgttacggagagttagaggatggagtagtggtgttagggagagttagaggatggagtggtggtgttagggagagttagaggttggagtggtggtgttagggagagttagaggatggagtggtggtgttacggagagttagaggatggagtggtggtgttatggagagttagaggatggaggggtggtgttacggagagttagaggatggagtggtggtgttagggagagttag

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU606463 True 966 lncRNA 0.51 4 65305399 65307541
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110526352 LOC106587214 coding downstream 171574 65113278 ~ 65133825 (-)
LOC110526350 LOC106562128 coding downstream 331632 64958215 ~ 64973767 (-)
LOC118965085 LOC106587172 coding downstream 406851 64897435 ~ 64898548 (-)
LOC110526341 LOC106562136 coding downstream 590285 64697204 ~ 64715114 (-)
LOC110526338 LOC106587230 coding downstream 662765 64509743 ~ 64642634 (-)
LOC110526361 LOC106587207 coding upstream 218131 65525672 ~ 65546448 (-)
LOC110526365 LOC106587205 coding upstream 292556 65600097 ~ 65765382 (-)
LOC110526369 xlkd1 coding upstream 485278 65792819 ~ 65795668 (-)
LOC110526367 LOC106587202 coding upstream 490532 65798073 ~ 65820337 (-)
LOC110526945 LOC106562099 coding upstream 519388 65826929 ~ 65828077 (-)
G535546 NA non-coding downstream 120185 65184543 ~ 65185214 (-)
G535545 NA non-coding downstream 121825 65183272 ~ 65183574 (-)
G535535 NA non-coding downstream 144075 65159200 ~ 65161324 (-)
G535528 NA non-coding downstream 163513 65139909 ~ 65141886 (-)
G535431 LOC106562126 non-coding downstream 325085 64980010 ~ 64980314 (-)
G535603 NA non-coding upstream 53464 65361005 ~ 65368565 (-)
G535653 NA non-coding upstream 65473 65373014 ~ 65373280 (-)
G535654 NA non-coding upstream 66984 65374525 ~ 65374778 (-)
G535663 NA non-coding upstream 84996 65392537 ~ 65392758 (-)
G535604 NA non-coding upstream 107032 65414573 ~ 65430407 (-)
G534603 NA other downstream 419867 64855495 ~ 64895099 (-)
G534349 NA other downstream 690603 64578798 ~ 64614796 (-)
G534201 NA other downstream 805785 64498453 ~ 64499614 (-)
igdcc3 LOC106562146 other downstream 1479874 63823887 ~ 63944930 (-)
LOC110526310 LOC106587159 other downstream 2315121 62985486 ~ 62991995 (-)
G536183 NA other upstream 954945 66262486 ~ 66276289 (-)
LOC110526379 LOC106587193 other upstream 969661 66277162 ~ 66326558 (-)
LOC110526387 LOC106587187 other upstream 1192847 66499996 ~ 66505055 (-)
G536630 LOC106562092 other upstream 1241826 66549367 ~ 66549974 (-)

Expression


G535619 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G535619 Expression in each Bioproject

Bar chart with 6 bars.
G535619 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 250.
End of interactive chart.

Co-expression Network