G535604



Basic Information


Item Value
gene id G535604
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 65414573 ~ 65430407 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU606448
CAGCAGAATCAATAGATATTTCTTTATTAAATTCATAATTTTATTCACAACAGGAGAGTGTGGATTAAATCAACAGACACCAGGACAAGGCAGAGACTTATGTCCATGCCCAGATCCTCAGGTGTGGAGATACCCAGCTCAATCAGAGTGGGCTGCAGTTCTTGAATCAGGTATGGGTAGATATCTTTGTGGGGACCAGATTTGTCCTTGACTGCCTCGAGGATGCGGATAGCACTGGCCAAGTCATTCAACCTTCGGCAAGCACGAAGAGCTGAGTCGAGGATTTTGGGTTCAGGTACCAGGTCATAGCCAATTAGTGTGTTCATGCCTTTCTTCAGCTCCCAGGCATCAATGTCTGGCTTGCTGAAATAAGTGACCCAACGGGCATCAAACTCCTCATCTGTCTCCACCTTGGCATGGGAGTAGCATCGGGAGGCCAAAGGAGCCGAGTAGCATGGTCGTGTCCGCGTTAAACTCCGTACCCCAGAGGTTGAAAGTCGAACAACAGGTCTGAACATCTTGCCGACCGGTGAGAATTAGTGGCTAACGGTGTCGTATGCTAAGGAACCGAGTCAGA

Function


NR:

description
Cytochrome c oxidase subunit 5A, mitochondrial precursor

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU606448 True 577 lncRNA 0.49 5 65414573 65430407
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110526352 LOC106587214 coding downstream 280748 65113278 ~ 65133825 (-)
LOC110526350 LOC106562128 coding downstream 440806 64958215 ~ 64973767 (-)
LOC118965085 LOC106587172 coding downstream 516025 64897435 ~ 64898548 (-)
LOC110526341 LOC106562136 coding downstream 699459 64697204 ~ 64715114 (-)
LOC110526338 LOC106587230 coding downstream 771939 64509743 ~ 64642634 (-)
LOC110526361 LOC106587207 coding upstream 95265 65525672 ~ 65546448 (-)
LOC110526365 LOC106587205 coding upstream 169690 65600097 ~ 65765382 (-)
LOC110526369 xlkd1 coding upstream 362412 65792819 ~ 65795668 (-)
LOC110526367 LOC106587202 coding upstream 367666 65798073 ~ 65820337 (-)
LOC110526945 LOC106562099 coding upstream 396522 65826929 ~ 65828077 (-)
G535663 NA non-coding downstream 21815 65392537 ~ 65392758 (-)
G535654 NA non-coding downstream 39795 65374525 ~ 65374778 (-)
G535653 NA non-coding downstream 41293 65373014 ~ 65373280 (-)
G535603 NA non-coding downstream 46008 65361005 ~ 65368565 (-)
G535600 NA non-coding downstream 76951 65290125 ~ 65337622 (-)
G535693 NA non-coding upstream 10144 65440551 ~ 65440709 (-)
G535695 LOC106587208 non-coding upstream 13094 65443501 ~ 65444112 (-)
G535703 NA non-coding upstream 29369 65459776 ~ 65460005 (-)
G535713 NA non-coding upstream 39398 65469805 ~ 65470008 (-)
G535731 NA non-coding upstream 60684 65491091 ~ 65529060 (-)
G534603 NA other downstream 529041 64855495 ~ 64895099 (-)
G534349 NA other downstream 799777 64578798 ~ 64614796 (-)
G534201 NA other downstream 914959 64498453 ~ 64499614 (-)
igdcc3 LOC106562146 other downstream 1589048 63823887 ~ 63944930 (-)
LOC110526310 LOC106587159 other downstream 2424295 62985486 ~ 62991995 (-)
G536183 NA other upstream 832079 66262486 ~ 66276289 (-)
LOC110526379 LOC106587193 other upstream 846795 66277162 ~ 66326558 (-)
LOC110526387 LOC106587187 other upstream 1069981 66499996 ~ 66505055 (-)
G536630 LOC106562092 other upstream 1118960 66549367 ~ 66549974 (-)

Expression


G535604 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 250.
End of interactive chart.

G535604 Expression in each Bioproject

Bar chart with 19 bars.
G535604 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 3000.
End of interactive chart.

Co-expression Network