G538507 (pigb)


Basic Information

Item Value
gene id G538507
gene name pigb
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 68626445 ~ 68626777 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU609803
CTGCGTCATAGGTGAAGAAGTGCAAAATCTTATATATAGCTGCAAAGAAGAGAGGGTAGGAGAACCCTCTTATACCTGCTGTCCACTCCCACGTCAAATAGCCATAGTCAAAAACCATAAGATGAGCGATTTCGAGGGACTGCCAGTATTCATCTGGGACAAAGCTGGTCTGGACTAGGAAGCAGTTGATGAGACGAAATGCCACAGTGAAGACAGTGACCCCCAATACA

Function

symbol description
pigb Predicted to enable alpha-1,2-mannosyltransferase activity. Predicted to be involved in GPI anchor biosynthetic process. Predicted to be located in endoplasmic reticulum and membrane. Predicted to be integral component of membrane. Predicted to be active in endoplasmic reticulum membrane. Human ortholog(s) of this gene implicated in developmental and epileptic encephalopathy 80. Orthologous to human PIGB (phosphatidylinositol glycan anchor biosynthesis class B).

NR:

description
GPI mannosyltransferase 3 isoform X4

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU609803 True 230 lncRNA 0.46 2 68626445 68626777

Neighbor

gene id symbol gene type direction distance location
LOC110526427 ccpg1 coding upstream 2557 68605596 ~ 68623888 (+)
LOC110526429 LOC106587430 coding upstream 22992 68597118 ~ 68603453 (+)
LOC110526426 LOC106587432 coding upstream 30862 68550900 ~ 68595583 (+)
LOC110526425 LOC106587433 coding upstream 80296 68495029 ~ 68546149 (+)
LOC110526423 LOC106587434 coding upstream 141726 68441334 ~ 68484719 (+)
LOC110526430 LOC106587426 coding downstream 797 68627574 ~ 68640613 (+)
LOC110526432 LOC106587425 coding downstream 14013 68640790 ~ 68644591 (+)
LOC110526434 cog4 coding downstream 18051 68644828 ~ 68664392 (+)
LOC110526436 LOC107688027 coding downstream 52540 68679317 ~ 68681675 (+)
LOC110526444 LOC106587414 coding downstream 148697 68775474 ~ 68780317 (+)
G538010 NA non-coding upstream 76955 68549132 ~ 68549490 (+)
G538008 NA non-coding upstream 78969 68547156 ~ 68547476 (+)
G538021 NA non-coding upstream 100156 68487682 ~ 68526289 (+)
G538011 NA non-coding upstream 101178 68517754 ~ 68525267 (+)
G538001 NA non-coding upstream 177550 68445524 ~ 68448895 (+)
G538554 NA non-coding downstream 68930 68695707 ~ 68695910 (+)
G538555 NA non-coding downstream 70098 68696875 ~ 68697228 (+)
G538559 NA non-coding downstream 75848 68702625 ~ 68702966 (+)
G538562 NA non-coding downstream 77988 68704765 ~ 68705103 (+)
G538563 NA non-coding downstream 78411 68705188 ~ 68705423 (+)
G537617 atxn1l other upstream 858832 67766756 ~ 67767613 (+)
G537606 NA other upstream 869827 67754556 ~ 67756618 (+)
G537032 LOC106587324 other upstream 1515817 67109676 ~ 67110628 (+)
G537029 zfhx3 other upstream 1521537 67104306 ~ 67104908 (+)
G536995 zfhx3 other upstream 1607792 67013220 ~ 67018653 (+)
G538561 NA other downstream 77621 68704398 ~ 68704696 (+)
G538607 NA other downstream 184342 68811119 ~ 68811890 (+)
G538859 NA other downstream 279268 68906045 ~ 68906847 (+)
G538877 LOC106582599 other downstream 369306 68996083 ~ 69002828 (+)

Expression


Co-expression Network