G542022



Basic Information


Item Value
gene id G542022
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 72001916 ~ 72002219 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU613779
GACTTGCCCACTTCGGCCTTGGCCATCCTTCCCGTAGCGCTGTCCGTTCAAACGTACAGAGGTATGTTTCGATGTCATCGTCTTCCGTCAGCTTGATTAAAAACTGGTTGGGATGTGATTCAGGAGATGCTCCTCCTTGCAGCTTCCTGATTTCCTCAACGAGGCGGATGTTTTGTAATCGCTGTTCCTCCAGCGTTCGTTCCTGAACCGCCTGTTGTGCTTGTTGGGCCTGGACGAACTGAGCTATCATCTCGACCATGCTGATGCTGTGTAAATGTCAACCCTGATCTGACCACGTTATCAG

Function


NR:

description
SH2 domain-containing protein 4B-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU613779 True 304 lncRNA 0.51 1 72001916 72002219
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118964930 NA coding upstream 34114 71961924 ~ 71967802 (+)
LOC110526495 LOC106587464 coding upstream 311556 71681601 ~ 71690360 (+)
cmc2 cmc2 coding upstream 1380406 70615476 ~ 70621510 (+)
si:ch73-103b9.2 cssa26h16orf46 coding upstream 1402728 70594747 ~ 70599188 (+)
LOC110526485 fam92b coding upstream 1443818 70551763 ~ 70558098 (+)
LOC110526507 LOC106587468 coding downstream 8876 72011095 ~ 72021875 (+)
LOC110526509 LOC106563533 coding downstream 71931 72074150 ~ 72098245 (+)
LOC110526510 pkp3 coding downstream 115519 72117738 ~ 72135463 (+)
LOC110526514 LOC106563530 coding downstream 154971 72157190 ~ 72181309 (+)
LOC110526515 LOC106587477 coding downstream 182853 72185072 ~ 72207042 (+)
G542021 NA non-coding upstream 695 72001016 ~ 72001221 (+)
G542011 NA non-coding upstream 24435 71977214 ~ 71977481 (+)
G542010 NA non-coding upstream 24975 71976616 ~ 71976941 (+)
G542009 NA non-coding upstream 26398 71975196 ~ 71975518 (+)
G542006 NA non-coding upstream 31014 71970397 ~ 71970902 (+)
G542092 NA non-coding downstream 139297 72141516 ~ 72142559 (+)
G542137 NA non-coding downstream 272097 72274316 ~ 72292811 (+)
G542162 NA non-coding downstream 294525 72296744 ~ 72296989 (+)
G542131 LOC106587483 non-coding downstream 339693 72341912 ~ 72343982 (+)
G542179 NA non-coding downstream 342718 72344937 ~ 72345730 (+)
G541903 NA other upstream 197454 71800040 ~ 71804462 (+)
G540179 NA other upstream 1517548 70481950 ~ 70484368 (+)
LOC110525047 psf2 other upstream 1962409 70036194 ~ 70039507 (+)
G542053 NA other downstream 99161 72101380 ~ 72102474 (+)
G542100 LOC106587475 other downstream 148801 72151020 ~ 72152394 (+)
saa saa other downstream 663241 72665460 ~ 72666872 (+)
G542890 NA other downstream 763462 72765681 ~ 72766851 (+)
LOC110526543 LOC106587517 other downstream 1036402 73037953 ~ 73182742 (+)

Expression


G542022 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G542022 Expression in each Bioproject

Bar chart with 17 bars.
G542022 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network