G542162



Basic Information


Item Value
gene id G542162
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 72296744 ~ 72296989 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU613943
ttaaaaatgtttacccccaatttcatggtatccaattgttgtagtagctactatcttgtctcatcgctacaactcccgtacgggctcgggagagacgaaggttgaaagtcatgcttcctccgatacacaacccaaccagccgcactgcttcttaacacagcgcgcatccaacccggaagccagccgcaccaatgtgtcggaggctacaccgtgcacctggcaaccttggctagcggacatccctac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU613943 True 246 lncRNA 0.52 1 72296744 72296989
Loading

Neighbor


gene id symbol gene type direction distance location
LOC100136249 LOC100136249 coding upstream 1847 72287031 ~ 72294897 (+)
LOC110526517 LOC106587478 coding upstream 52280 72221348 ~ 72244464 (+)
LOC110526515 LOC106587477 coding upstream 89702 72185072 ~ 72207042 (+)
LOC110526514 LOC106563530 coding upstream 115435 72157190 ~ 72181309 (+)
LOC110526510 pkp3 coding upstream 161281 72117738 ~ 72135463 (+)
mybpc3 LOC106587482 coding downstream 1004 72297993 ~ 72339964 (+)
LOC118965108 NA coding downstream 35647 72332636 ~ 72332690 (+)
LOC110526523 LOC106587484 coding downstream 273828 72570817 ~ 72595606 (+)
LOC110526524 LOC106587487 coding downstream 316706 72613695 ~ 72631381 (+)
LOC110526527 lin7c coding downstream 335792 72632781 ~ 72638350 (+)
G542137 NA non-coding upstream 3933 72274316 ~ 72292811 (+)
G542092 NA non-coding upstream 154185 72141516 ~ 72142559 (+)
G542022 NA non-coding upstream 294525 72001916 ~ 72002219 (+)
G542021 NA non-coding upstream 295523 72001016 ~ 72001221 (+)
G542011 NA non-coding upstream 319263 71977214 ~ 71977481 (+)
G542131 LOC106587483 non-coding downstream 44923 72341912 ~ 72343982 (+)
G542179 NA non-coding downstream 47948 72344937 ~ 72345730 (+)
G542180 NA non-coding downstream 49838 72346827 ~ 72347198 (+)
G542181 NA non-coding downstream 50461 72347450 ~ 72348095 (+)
G542183 NA non-coding downstream 53097 72350086 ~ 72350298 (+)
G542100 LOC106587475 other upstream 144350 72151020 ~ 72152394 (+)
G542053 NA other upstream 194270 72101380 ~ 72102474 (+)
G541903 NA other upstream 492282 71800040 ~ 71804462 (+)
cmc2 cmc2 other upstream 1675270 70615476 ~ 70621510 (+)
LOC110526485 fam92b other upstream 1742824 70551763 ~ 70558098 (+)
saa saa other downstream 368471 72665460 ~ 72666872 (+)
G542890 NA other downstream 468692 72765681 ~ 72766851 (+)
LOC110526543 LOC106587517 other downstream 741632 73037953 ~ 73182742 (+)
LOC100136290 sox6 other downstream 1075816 73190979 ~ 73392251 (+)
G544565 NA other downstream 1990789 74287778 ~ 74288138 (+)

Expression


G542162 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G542162 Expression in each Bioproject

Bar chart with 20 bars.
G542162 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network