G544950 (LOC107579696)


Basic Information

Item Value
gene id G544950
gene name LOC107579696
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 74467086 ~ 74467838 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU617069
cgaaaacaaagatgttcagcatgtctctcaggacatcattgactaatgcctgaaagacagctgtagcgttagcgaggccgaaaggaagaacccggtattcaaagtgccctaacggagtgttaaacgccgtcttccactcgtccccctccctgatgcgcacgagatggtaagcgttacgaaggtccaacttagtgaaaaacctggctccctgcaggatctcgaaggctgaagacataagaggaagcggataacgattcttcactgttatgtcattcagccctcgataatctatgcaggggcgcagggacccgtccttcttcttaacaaaaaaaaaccccgctccggcgggagaggaggaggggactatggtaccggcggcaagagctacagacaaataatcttcgagagccttacgttcgggagccgacagagaatatagtctaccccgggggggagtggttcccggaaggagatcaatactacaatcatacgaccggtgtggaggaagagaggtggccctggaccgactgaacaccgtgcacagatcgtgatattcctccggcacccctgtcaaatcaccaggctcctcctgtgaagaagagacagaggaaacaggagggatagcagacattaaacatttcacatgacaagagacgttccaggagaggatagaattactagaccaattaatggaaggattatgacaaactagccagggatggcccaaaacaacaggtgtaaaaggtgaacgaa

Function

NR:

description
PREDICTED: uncharacterized protein LOC109045530

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU617069 True 753 lncRNA 0.50 1 74467086 74467838
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110526566 LOC106587546 coding downstream 121853 74337729 ~ 74345233 (-)
dennd5a LOC106587543 coding downstream 133166 74274850 ~ 74333920 (-)
sinhcafl fa60a coding downstream 192670 74269202 ~ 74274416 (-)
scube2 LOC106587542 coding downstream 199611 74247042 ~ 74267475 (-)
tmem9b LOC106587541 coding downstream 220840 74242304 ~ 74246246 (-)
LOC110526574 LOC106587558 coding upstream 148626 74616464 ~ 74630725 (-)
LOC110526578 LOC106587560 coding upstream 198638 74666476 ~ 74673302 (-)
LOC110526965 LOC106587563 coding upstream 330206 74798044 ~ 74837516 (-)
LOC110526966 LOC106587565 coding upstream 736586 75204424 ~ 75315717 (-)
LOC110526586 LOC106587568 coding upstream 871692 75339530 ~ 75395049 (-)
G544949 NA non-coding downstream 1235 74465623 ~ 74465851 (-)
G544909 LOC106587548 non-coding downstream 74981 74391012 ~ 74392105 (-)
G544901 NA non-coding downstream 88088 74378769 ~ 74378998 (-)
G544884 NA non-coding downstream 131873 74334797 ~ 74335213 (-)
G544689 NA non-coding downstream 168299 74298324 ~ 74298787 (-)
G544952 NA non-coding upstream 2270 74470108 ~ 74470483 (-)
G544966 NA non-coding upstream 15650 74483488 ~ 74483846 (-)
G544978 NA non-coding upstream 33420 74501258 ~ 74501467 (-)
G544959 LOC106587553 non-coding upstream 107480 74575318 ~ 74580176 (-)
G545017 NA non-coding upstream 114527 74582365 ~ 74582603 (-)
G544923 NA other downstream 33794 74413305 ~ 74433292 (-)
G544882 LOC106562356 other downstream 106664 74359261 ~ 74360422 (-)
G543823 NA other downstream 904223 73562359 ~ 73562863 (-)
G546283 NA other upstream 1235600 75703438 ~ 75728474 (-)
G547165 NA other upstream 2058983 76526821 ~ 76527268 (-)
G547378 LOC106587591 other upstream 2204490 76672328 ~ 76672839 (-)

Expression

G544950(LOC107579696) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G544950(LOC107579696) Expression in each Bioproject

Bar chart with 20 bars.
G544950(LOC107579696) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network