G544757



Basic Information


Item Value
gene id G544757
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 74468264 ~ 74468808 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU616841
tctagacagttcattgtcgaggttgacgcgtcagaggtgggcgtgggagccattctttctcagcgctccttctctgacgacaaggtccacccttgcgcgtatttttctcatcgcctgtcgccgtcggaacgtaactatgatgtgggaaactgcgaactgctcgccatccgcttagccctaggcgaatggcgacagtggttggagggggcgaccgttccttttgtcgtttggactgaccataggaaccttgagtacatccgttctgccaaacgacttaatgcgcgtcaggcgcgctgggcgctgtttttcgctcgtttcgagttcgtgatttcttatcgtccgggctctaagaacaccaagcctgatgctttatctcgtctcttcagttcttcagtagcctccactgaccccgaggggattctccctgaggggcgtgttgtcgggttgactgtctggggaattgagaggcaggtaaagcaagcactcactcaaactccgtcgccgcgcgcttgtcccaggaaccttcttttcgttcccgttcctac

Function


NR:

description
Retrotransposable element Tf2 protein type 1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU616841 True 545 lncRNA 0.55 1 74468264 74468808
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110526569 LOC106562354 coding upstream 4450 74443137 ~ 74463814 (+)
LOC110526568 LOC106587550 coding upstream 37587 74395368 ~ 74430677 (+)
LOC110526567 wee1 coding upstream 73227 74389782 ~ 74395037 (+)
LOC110526565 LOC106562357 coding upstream 90235 74363115 ~ 74378029 (+)
LOC118965110 NA coding upstream 107585 74360536 ~ 74360679 (+)
LOC110526570 cyp1a3 coding downstream 36236 74505044 ~ 74509032 (+)
LOC110526571 LOC106562351 coding downstream 40639 74509447 ~ 74536436 (+)
LOC110526572 LOC106562350 coding downstream 68137 74536945 ~ 74580991 (+)
LOC110515568 LOC106587555 coding downstream 132706 74601514 ~ 74607809 (+)
LOC110526573 LOC106594537 coding downstream 140583 74609391 ~ 74612035 (+)
G544756 LOC105416325 non-coding upstream 292 74467627 ~ 74467972 (+)
G544754 NA non-coding upstream 2239 74465824 ~ 74466025 (+)
G544591 NA non-coding upstream 134332 74333602 ~ 74333932 (+)
G544586 NA non-coding upstream 143020 74324910 ~ 74325244 (+)
G544580 NA non-coding upstream 151407 74314342 ~ 74316857 (+)
G544758 NA non-coding downstream 1174 74469982 ~ 74470458 (+)
G544761 NA non-coding downstream 11350 74480158 ~ 74480412 (+)
G544766 NA non-coding downstream 23470 74492278 ~ 74492583 (+)
G544739 NA non-coding downstream 27282 74496090 ~ 74499096 (+)
G544817 NA non-coding downstream 125986 74594794 ~ 74595064 (+)
G544565 NA other upstream 180126 74287778 ~ 74288138 (+)
LOC100136290 sox6 other upstream 1080577 73190979 ~ 73392251 (+)
LOC110526543 LOC106587517 other upstream 1322917 73037953 ~ 73182742 (+)
G542890 NA other upstream 1701413 72765681 ~ 72766851 (+)
saa saa other upstream 1801392 72665460 ~ 72666872 (+)
G545485 NA other downstream 768992 75237800 ~ 75238164 (+)
G545601 NA other downstream 953053 75421861 ~ 75422752 (+)
G546464 LOC106562315 other downstream 1459420 75928228 ~ 75970674 (+)
LOC110526968 fto other downstream 2418624 76827001 ~ 77038395 (+)
G547884 NA other downstream 2809184 77277992 ~ 77279354 (+)

Expression


G544757 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G544757 Expression in each Bioproject

Bar chart with 20 bars.
G544757 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network