G544758



Basic Information


Item Value
gene id G544758
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 74469982 ~ 74470458 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU616842
cggtcctgaggagaggagttgggttccctctcgggacgtgctggaccgtgcgctgatcgatgatttcctccgttgccgccaggtttcctcctcgagtgcgccaggaggcgctcggtgagtgggggggtactgtcatgtattgtcatgttgtgtcttgtttctgtcctttcccttcaccctgtctccctctgctggtcgttattaggttaccttttctccccctctttcccccagctgttccttgtctcctcctaactacctcgtcaccccttttcccacctgttccctttttccctctgattagtcctctatatctctctctgttttgtttctgtctttgtcggattcttgtttgtgttattcatgcctgaaccagactatcgtcatgtttgctgcaaccttgtcctgtcctgtcggaatctgccggtccatctgagcctacgtttgttttgttattaaagaagctctgtttacgtt

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU616842 True 477 lncRNA 0.51 1 74469982 74470458

Neighbor


gene id symbol gene type direction distance location
LOC110526569 LOC106562354 coding upstream 6168 74443137 ~ 74463814 (+)
LOC110526568 LOC106587550 coding upstream 39305 74395368 ~ 74430677 (+)
LOC110526567 wee1 coding upstream 74945 74389782 ~ 74395037 (+)
LOC110526565 LOC106562357 coding upstream 91953 74363115 ~ 74378029 (+)
LOC118965110 NA coding upstream 109303 74360536 ~ 74360679 (+)
LOC110526570 cyp1a3 coding downstream 34586 74505044 ~ 74509032 (+)
LOC110526571 LOC106562351 coding downstream 38989 74509447 ~ 74536436 (+)
LOC110526572 LOC106562350 coding downstream 66487 74536945 ~ 74580991 (+)
LOC110515568 LOC106587555 coding downstream 131056 74601514 ~ 74607809 (+)
LOC110526573 LOC106594537 coding downstream 138933 74609391 ~ 74612035 (+)
G544757 NA non-coding upstream 1174 74468264 ~ 74468808 (+)
G544756 LOC105416325 non-coding upstream 2010 74467627 ~ 74467972 (+)
G544754 NA non-coding upstream 3957 74465824 ~ 74466025 (+)
G544591 NA non-coding upstream 136050 74333602 ~ 74333932 (+)
G544586 NA non-coding upstream 144738 74324910 ~ 74325244 (+)
G544761 NA non-coding downstream 9700 74480158 ~ 74480412 (+)
G544766 NA non-coding downstream 21820 74492278 ~ 74492583 (+)
G544739 NA non-coding downstream 25632 74496090 ~ 74499096 (+)
G544817 NA non-coding downstream 124336 74594794 ~ 74595064 (+)
G544828 NA non-coding downstream 141633 74612091 ~ 74612578 (+)
G544565 NA other upstream 181844 74287778 ~ 74288138 (+)
LOC100136290 sox6 other upstream 1082295 73190979 ~ 73392251 (+)
LOC110526543 LOC106587517 other upstream 1324635 73037953 ~ 73182742 (+)
G542890 NA other upstream 1703131 72765681 ~ 72766851 (+)
saa saa other upstream 1803110 72665460 ~ 72666872 (+)
G545485 NA other downstream 767342 75237800 ~ 75238164 (+)
G545601 NA other downstream 951403 75421861 ~ 75422752 (+)
G546464 LOC106562315 other downstream 1457770 75928228 ~ 75970674 (+)
LOC110526968 fto other downstream 2416974 76827001 ~ 77038395 (+)
G547884 NA other downstream 2807534 77277992 ~ 77279354 (+)

Expression


G544758 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G544758 Expression in each Bioproject

Bar chart with 20 bars.
G544758 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network