G545485



Basic Information


Item Value
gene id G545485
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 75237800 ~ 75238164 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU617662
atcatggtttgggcctgcttttcttcagcagggacagggaagatggttaaatttgatgggaagatggatggagccaaatacaggaccattctggaagaaaacctgatggagtctgcaaaagacctgagactgggacggagatttgtcttccaacaagacattgatccaaaacataaagcaaaatctacaatggaatggttcaaaaataaacatatccaggtgttagaatggccaagtcaaagtccagacctgaatccaatcgagaatctgtggaaagaactgaaaactgctgttcacaaatgctctccatccaacctcactgagctcgagctgttttgcaaggaggaatgggaaaaaatttcagt

Function


NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU617662 True 365 TUCP 0.42 1 75237800 75238164

Neighbor


gene id symbol gene type direction distance location
LOC110526583 LOC106562374 coding upstream 43110 75168568 ~ 75194690 (+)
LOC110526582 LOC106562373 coding upstream 82272 74922396 ~ 75155528 (+)
LOC118965044 LOC106609580 coding upstream 334117 74902940 ~ 74903683 (+)
LOC110526579 LOC106562344 coding upstream 442431 74777279 ~ 74795369 (+)
LOC110526577 LOC106587561 coding upstream 505271 74672184 ~ 74732529 (+)
LOC110526584 LOC106587566 coding downstream 78341 75316505 ~ 75324636 (+)
LOC110526588 LOC106562377 coding downstream 155633 75393797 ~ 75408675 (+)
LOC110526592 LOC106587573 coding downstream 216823 75454987 ~ 75456513 (+)
LOC110526593 cnep1r1 coding downstream 218438 75456602 ~ 75459378 (+)
heatr3 LOC106587571 coding downstream 221495 75459659 ~ 75468641 (+)
G545481 NA non-coding upstream 5598 75231856 ~ 75232202 (+)
G545479 NA non-coding upstream 7436 75230066 ~ 75230364 (+)
G545478 NA non-coding upstream 8873 75228688 ~ 75228927 (+)
G545470 NA non-coding upstream 20183 75217338 ~ 75217617 (+)
G545464 NA non-coding upstream 31158 75206283 ~ 75206642 (+)
G545494 NA non-coding downstream 7652 75245816 ~ 75246243 (+)
G545504 NA non-coding downstream 17210 75255374 ~ 75255580 (+)
G545506 NA non-coding downstream 18838 75257002 ~ 75257228 (+)
G545492 NA non-coding downstream 96846 75335010 ~ 75337018 (+)
G545600 NA non-coding downstream 180885 75419049 ~ 75490051 (+)
G544565 NA other upstream 949662 74287778 ~ 74288138 (+)
LOC100136290 sox6 other upstream 1850113 73190979 ~ 73392251 (+)
LOC110526543 LOC106587517 other upstream 2092453 73037953 ~ 73182742 (+)
G542890 NA other upstream 2470949 72765681 ~ 72766851 (+)
saa saa other upstream 2570928 72665460 ~ 72666872 (+)
G545601 NA other downstream 183697 75421861 ~ 75422752 (+)
G546464 LOC106562315 other downstream 690064 75928228 ~ 75970674 (+)
LOC110526968 fto other downstream 1649268 76827001 ~ 77038395 (+)
G547884 NA other downstream 2039828 77277992 ~ 77279354 (+)
G548000 NA other downstream 2274445 77512609 ~ 77523423 (+)

Expression


G545485 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G545485 Expression in each Bioproject

Bar chart with 20 bars.
G545485 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network