G546539



Basic Information


Item Value
gene id G546539
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 76028675 ~ 76028913 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU618812
CACCATAGCTTCCTCAGTGGTTTTTTCATCTCGAGCATCAAACACCCAAGGGGTGCCGAGAATTGCACCGGATTTCGCCATGCTGTTGGCATGGTCGTTGCCAAGTTTGTCACGACCAGGTGATTTGGAGTGTCCCTTGACTTTCTTCCAATACACCTGTATGTCGTGTTTGGTGATGAGGTCATCACAAGCTAGGATGAGCTCTTTGTTTTTCACCTCTTCACCACTTGAAGTAGTCA

Function


NR:

description
PREDICTED: uncharacterized protein LOC106531661, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU618812 True 239 lncRNA 0.48 1 76028675 76028913
Loading

Neighbor


gene id symbol gene type direction distance location
sall1a LOC106587587 coding downstream 44987 75969021 ~ 75983688 (-)
LOC110526598 m4a4a coding downstream 284162 75741757 ~ 75744513 (-)
LOC118936660 NA coding downstream 288461 75733636 ~ 75740214 (-)
LOC110526597 brd7 coding downstream 444626 75573111 ~ 75584049 (-)
LOC110526589 LOC106562336 coding downstream 574689 75449759 ~ 75453986 (-)
LOC110526602 tox3 coding upstream 286058 76314971 ~ 76379993 (-)
LOC110526603 NA coding upstream 539973 76568886 ~ 76570715 (-)
LOC110526606 LOC106587590 coding upstream 542452 76571365 ~ 76586989 (-)
chd9 chd9 coding upstream 562810 76591723 ~ 76723031 (-)
aktip LOC106587594 coding upstream 695513 76724426 ~ 76732941 (-)
G546538 NA non-coding downstream 904 76027536 ~ 76027771 (-)
G546445 NA non-coding downstream 118499 75907157 ~ 75910176 (-)
G546436 NA non-coding downstream 129456 75898958 ~ 75899219 (-)
G546379 NA non-coding downstream 183822 75836254 ~ 75844853 (-)
G546342 NA non-coding downstream 206334 75822048 ~ 75822341 (-)
G546601 NA non-coding upstream 66305 76095218 ~ 76097766 (-)
G546609 NA non-coding upstream 81331 76110244 ~ 76110455 (-)
G546610 NA non-coding upstream 82489 76111402 ~ 76111613 (-)
G546627 NA non-coding upstream 99511 76128424 ~ 76128659 (-)
G546654 NA non-coding upstream 108053 76136966 ~ 76137169 (-)
G546283 NA other downstream 300201 75703438 ~ 75728474 (-)
LOC110526965 LOC106587563 other downstream 1229192 74798044 ~ 74837516 (-)
LOC110526574 LOC106587558 other downstream 1400432 74616464 ~ 74630725 (-)
G544923 NA other downstream 1595383 74413305 ~ 74433292 (-)
G544882 LOC106562356 other downstream 1668253 74359261 ~ 74360422 (-)
G547165 NA other upstream 497908 76526821 ~ 76527268 (-)
G547378 LOC106587591 other upstream 643415 76672328 ~ 76672839 (-)
G547381 NA other upstream 650566 76679479 ~ 76681822 (-)
G547663 NA other upstream 893041 76921954 ~ 76928469 (-)
G548203 NA other upstream 1365086 77393999 ~ 77396655 (-)

Expression


G546539 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G546539 Expression in each Bioproject

Bar chart with 6 bars.
G546539 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network