G547239 (chd9)


Basic Information

Item Value
gene id G547239
gene name chd9
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 76626198 ~ 76629445 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU619546
TGTCTCTGGAGTACATCTCGTACTGCTGCAGCATCTGCCTGCTGACCATGGAGCCGTGGTAGACAATAACGTTGAGGTGGGTCCACGTTCTGAACTCCCTCTCCCAGTTGGCGATGGTGGAGAGGGGGGCGATGATGAGGAAGGGGCCCCTGATGCCCACACGCCAGATCTCCTCCAGAAACGTGATGGACTGGATGGTCTTCCCCAGACCCATCTCATCTGCCAGGATACAGTTCCGTCTGTTGTACCAGTTGAAGAGGAGCCAGTTGACTCCCTCCAGCTGGTAGTCCCTGAGGACGTTACTGTTCCTGTACTCCCTCGACTGATCCCTCTTCTTCCACAGGCTGGCTGGGGGACGCTCCATCCTGCGGGAGTCTGGCCTTGCTGCCTGCAGCAGCTCAAACTCCTCTATTTTACTCTGG

Function

symbol description
chd9 Predicted to enable several functions, including ATP binding activity; DNA binding activity; and DNA helicase activity. Predicted to be located in nucleus. Is expressed in female organism. Orthologous to human CHD9 (chromodomain helicase DNA binding protein 9).

NR:

description
PREDICTED: chromodomain-helicase-DNA-binding protein 9-like, partial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU619546 True 422 lncRNA 0.57 3 76626198 76629445

Neighbor

gene id symbol gene type direction distance location
LOC118964933 chd9 coding upstream 6077 76604690 ~ 76620121 (+)
cylda LOC100380700 coding upstream 810967 75779416 ~ 75815231 (+)
nod2 nod2 coding upstream 860907 75752937 ~ 75765291 (+)
LOC110526967 LOC106587577 coding upstream 923596 75664369 ~ 75702602 (+)
LOC110526596 LOC106587576 coding upstream 1053295 75498696 ~ 75572903 (+)
LOC110526968 fto coding downstream 197556 76827001 ~ 77038395 (+)
irx5a irx5 coding downstream 866308 77495753 ~ 77499433 (+)
LOC110526613 LOC106587615 coding downstream 1094380 77723825 ~ 77730489 (+)
LOC110526614 mmp2 coding downstream 1184935 77814375 ~ 77847797 (+)
LOC110526615 pcat2 coding downstream 1219517 77848962 ~ 77866316 (+)
G547229 NA non-coding upstream 13213 76611408 ~ 76612985 (+)
G547163 NA non-coding upstream 102598 76522782 ~ 76523600 (+)
G546947 NA non-coding upstream 192917 76430843 ~ 76433281 (+)
G546907 NA non-coding upstream 227174 76389560 ~ 76399024 (+)
G547183 NA non-coding downstream 11986 76641431 ~ 76641992 (+)
G547278 NA non-coding downstream 47052 76676497 ~ 76677048 (+)
G547300 NA non-coding downstream 76179 76705624 ~ 76706152 (+)
G547303 NA non-coding downstream 80812 76710257 ~ 76710510 (+)
G547304 NA non-coding downstream 81769 76711214 ~ 76711438 (+)
G546464 LOC106562315 other upstream 655524 75928228 ~ 75970674 (+)
G545601 NA other upstream 1203446 75421861 ~ 75422752 (+)
G545485 NA other upstream 1388034 75237800 ~ 75238164 (+)
G544565 NA other upstream 2338060 74287778 ~ 74288138 (+)
LOC100136290 sox6 other upstream 3238511 73190979 ~ 73392251 (+)
G547884 NA other downstream 648547 77277992 ~ 77279354 (+)
G548000 NA other downstream 883164 77512609 ~ 77523423 (+)

Expression


Co-expression Network