G548642


Basic Information

Item Value
gene id G548642
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 78247736 ~ 78248253 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU621200
aatccattgtggaggaacaccaacagtatattttaagaacacattcttatttacaatgacggcctaccggggaacagtgggttaactgccttgttaactctgggattcgatccagcaacctctcggttactggcccaacgctctaaccactaggctacctgctggttactggtccaacgctctaaccactaggctacctgctggttactggcccaacgctctaaccactaggatacctgctggttactggcccaacgctctaaccactaagctacctgctggttactggcccaacgctctaaccactaggatacctgctggttactggcccaacgctctaaccactaagctacctgctggttactggcccaactctctaaccactaagctacctgccgccc

Function

NR:

description
membrane-associated guanylate kinase, WW and PDZ domain-containing protein 3-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU621200 True 401 lncRNA 0.51 2 78247736 78248253

Neighbor

gene id symbol gene type direction distance location
LOC110526623 LOC106587623 coding upstream 23581 78220534 ~ 78224155 (+)
LOC110526621 LOC106587617 coding upstream 120310 78103895 ~ 78127426 (+)
LOC110526620 lt4r1 coding upstream 157435 78088907 ~ 78090301 (+)
LOC110525051 LOC106587608 coding upstream 158990 78087216 ~ 78088746 (+)
LOC110526617 LOC106562414 coding upstream 205589 77968167 ~ 78042147 (+)
LOC110526630 LOC106562411 coding downstream 118480 78366733 ~ 78379992 (+)
LOC110526629 LOC106562410 coding downstream 133131 78381384 ~ 78389020 (+)
LOC110526970 LOC105022633 coding downstream 141205 78389458 ~ 78477958 (+)
LOC110526639 LOC106587637 coding downstream 254697 78502950 ~ 78511984 (+)
LOC110526640 LOC106562467 coding downstream 408857 78657110 ~ 78676158 (+)
G548573 NA non-coding upstream 59569 78128193 ~ 78188167 (+)
G548570 NA non-coding upstream 129886 78117091 ~ 78117850 (+)
G548498 NA non-coding upstream 312185 77934078 ~ 77935551 (+)
LOC110526615 pcat2 non-coding upstream 381868 77848962 ~ 77866316 (+)
G548629 NA non-coding downstream 103755 78352008 ~ 78409500 (+)
G548788 NA non-coding downstream 293040 78541293 ~ 78541498 (+)
G549207 NA non-coding downstream 299051 78547304 ~ 78547608 (+)
G549214 NA non-coding downstream 305245 78553498 ~ 78553802 (+)
G549224 NA non-coding downstream 315874 78564127 ~ 78564333 (+)
LOC110526614 mmp2 other upstream 430675 77814375 ~ 77847797 (+)
G548000 NA other upstream 724313 77512609 ~ 77523423 (+)
G547884 NA other upstream 968382 77277992 ~ 77279354 (+)
LOC110526968 fto other upstream 1211423 76827001 ~ 77038395 (+)
G548703 NA other downstream 172607 78420860 ~ 78496470 (+)
G549342 NA other downstream 521003 78769256 ~ 78769907 (+)
G549345 NA other downstream 523859 78772112 ~ 78772557 (+)
LOC110526645 unc13c other downstream 903111 79089592 ~ 79354959 (+)
G550054 NA other downstream 1231228 79479481 ~ 79480078 (+)

Expression


Co-expression Network