G550844



Basic Information


Item Value
gene id G550844
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 80594568 ~ 80595837 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU623755
GAAATAGACATCTGCATGTACTCTGATGACTGGAAATAGACATCTGCAGGTACTCTGATGACTGGAAATAGACATCTGCATGTACTCTGATGACTGGAAATAGACATCTGCATGTACTCTGATGACTGGAAATAGACATCTGCATGTACTCTGATGACTGGAAATAGACATCTGCATGTACTCTGATGACTGGAAATAGACATCTGCATGTACTCTGATGACTGGAAATAGACATCTGCATGTACTCTGATCACTGGACGTAGATCTTTACAACA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU623755 True 275 lncRNA 0.41 2 80594568 80595837
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110511230 slc24a5 coding downstream 125996 80431533 ~ 80468572 (-)
LOC110517805 slc12a1 coding downstream 215595 80334803 ~ 80378973 (-)
LOC110506796 dut coding downstream 271498 80318688 ~ 80323070 (-)
LOC110518431 LOC106587666 coding downstream 556344 80008833 ~ 80038224 (-)
LOC110518059 LOC106587633 coding downstream 639218 79947912 ~ 79955350 (-)
LOC110506809 LOC106587170 coding upstream 525161 81120998 ~ 81128689 (-)
LOC110515651 LOC100286620 coding upstream 557942 81153779 ~ 81265396 (-)
LOC118965046 NA coding upstream 767960 81363797 ~ 81364864 (-)
LOC110526108 LOC106587168 coding upstream 796996 81392833 ~ 81421390 (-)
LOC118964936 LOC106587815 coding upstream 871369 81467206 ~ 81481014 (-)
G550795 NA non-coding downstream 113230 80480121 ~ 80481338 (-)
G550779 NA non-coding downstream 163189 80431291 ~ 80431379 (-)
G550777 myef2 non-coding downstream 177239 80415431 ~ 80417329 (-)
G550700 NA non-coding downstream 186625 80407726 ~ 80407943 (-)
G550690 NA non-coding downstream 206190 80388076 ~ 80388378 (-)
G550854 NA non-coding upstream 28353 80624190 ~ 80624626 (-)
G550872 NA non-coding upstream 58893 80654730 ~ 80654983 (-)
G550876 NA non-coding upstream 62666 80658503 ~ 80658720 (-)
G550894 NA non-coding upstream 88267 80684104 ~ 80684811 (-)
G550895 NA non-coding upstream 89031 80684868 ~ 80685642 (-)
G550635 fbn1 other downstream 374293 80208663 ~ 80220275 (-)
G550612 secisbp2l other downstream 450157 80142024 ~ 80144411 (-)
LOC110526654 LOC106587669 other downstream 769927 79735466 ~ 79824666 (-)
G550403 LOC106587663 other downstream 1030555 79562784 ~ 79564013 (-)
G551159 NA other upstream 507776 81103613 ~ 81104022 (-)
LOC110506145 LOC105908085 other upstream 977600 81573413 ~ 81607084 (-)
G551579 NA other upstream 1000991 81596828 ~ 81597598 (-)
G551604 NA other upstream 1061815 81657652 ~ 81659254 (-)

Expression


G550844 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G550844 Expression in each Bioproject

Bar chart with 12 bars.
G550844 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network