G553404



Basic Information


Item Value
gene id G553404
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 83708717 ~ 83709973 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU626863
aggtttaacagtcctttagggttagggttaacagtcctttagggttaggtttaacagtcctttagggttaggtttaacagtcctttagggttaggtttaacagtcctttagggttaggtttaacagtcctttagggttagggttaacagtccattagggttaggtttaacagtcctttagggttaacagtcctttagggtt

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU626863 True 201 lncRNA 0.40 2 83708717 83709973
Loading

Neighbor


gene id symbol gene type direction distance location
LOC100136088 LOC106587743 coding downstream 3753 83647271 ~ 83704964 (-)
LOC110506170 NA coding downstream 166171 83529340 ~ 83542546 (-)
LOC110512367 LOC106562561 coding downstream 525349 83173467 ~ 83183368 (-)
LOC110506862 LOC106562715 coding downstream 800784 82887425 ~ 82907933 (-)
LOC110506861 LOC106562717 coding downstream 840074 82865251 ~ 82868643 (-)
LOC110526710 mesd1 coding upstream 26863 83736836 ~ 83738715 (-)
LOC118964944 cemip coding upstream 46250 83756223 ~ 83912000 (-)
LOC110526992 NA coding upstream 156435 83866408 ~ 83868699 (-)
LOC110526720 LOC106562647 coding upstream 215601 83925574 ~ 83954299 (-)
LOC110526723 arnt2 coding upstream 268431 83978404 ~ 84089424 (-)
G553388 NA non-coding downstream 45823 83662679 ~ 83662894 (-)
G553387 NA non-coding downstream 46107 83661387 ~ 83662610 (-)
G553384 NA non-coding downstream 61843 83643336 ~ 83646874 (-)
G553375 NA non-coding downstream 74544 83633632 ~ 83634173 (-)
G553373 NA non-coding downstream 76836 83631669 ~ 83631881 (-)
G553407 NA non-coding upstream 2946 83712919 ~ 83713263 (-)
G553411 NA non-coding upstream 8484 83718457 ~ 83719408 (-)
G553412 NA non-coding upstream 9542 83719515 ~ 83719730 (-)
G553413 NA non-coding upstream 10810 83720783 ~ 83720994 (-)
G553414 NA non-coding upstream 12306 83722279 ~ 83722491 (-)
G552980 NA other downstream 335521 83345201 ~ 83373196 (-)
G552584 LOC106587709 other downstream 1042272 82665477 ~ 82666445 (-)
G552558 NA other downstream 1088473 82612678 ~ 82620244 (-)
G552571 NA other downstream 1091523 82609918 ~ 82617194 (-)
G552533 pcsk6 other downstream 1142098 82564458 ~ 82566619 (-)
G553491 NA other upstream 166241 83876214 ~ 83879504 (-)
G553707 NA other upstream 388039 84098012 ~ 84175022 (-)
G554191 NA other upstream 942114 84652087 ~ 84652416 (-)
LOC110517996 cers3 other upstream 1003735 84699131 ~ 84727986 (-)

Expression


G553404 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G553404 Expression in each Bioproject

Bar chart with 5 bars.
G553404 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 800.
End of interactive chart.

Co-expression Network