G553516



Basic Information


Item Value
gene id G553516
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 83920031 ~ 83920237 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU627002
CACTGAGGGAGTTCCTGACAACTGTGGAACTGGCCTCACACTGAGGGAGTTCCTGACAACTGTTGATCAGGCCTCACACTGAGGGAGTTCCTGACAACTGTGGAACTGGCCTCACACTGAGGGAGTTCCTGACAACTGTTGATCAGGCCTCACACTGAGGGAGTTCCTGACAACTGTTGATCAGGCCTCACACTGAGGGAGTTCCTG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU627002 True 207 lncRNA 0.54 1 83920031 83920237

Neighbor


gene id symbol gene type direction distance location
LOC118964944 cemip coding downstream 8031 83756223 ~ 83912000 (-)
LOC110526992 NA coding downstream 51332 83866408 ~ 83868699 (-)
LOC110526710 mesd1 coding downstream 181316 83736836 ~ 83738715 (-)
LOC100136088 LOC106587743 coding downstream 215067 83647271 ~ 83704964 (-)
LOC110506170 NA coding downstream 377485 83529340 ~ 83542546 (-)
LOC110526720 LOC106562647 coding upstream 5337 83925574 ~ 83954299 (-)
LOC110526723 arnt2 coding upstream 58167 83978404 ~ 84089424 (-)
LOC110506870 fah coding upstream 306024 84226261 ~ 84250541 (-)
LOC110506882 LOC106562652 coding upstream 330759 84250996 ~ 84267954 (-)
LOC118964949 NA coding upstream 358018 84278255 ~ 84278855 (-)
G553514 NA non-coding downstream 5776 83914018 ~ 83914255 (-)
G553494 NA non-coding downstream 39690 83879637 ~ 83880341 (-)
G553493 NA non-coding downstream 41761 83876981 ~ 83878270 (-)
G553472 NA non-coding downstream 58911 83859974 ~ 83861120 (-)
G553441 NA non-coding downstream 76439 83786072 ~ 83843592 (-)
G553529 NA non-coding upstream 34701 83954938 ~ 83955223 (-)
G553547 NA non-coding upstream 49363 83969600 ~ 83969846 (-)
G553550 NA non-coding upstream 51020 83971257 ~ 83971519 (-)
G553613 NA non-coding upstream 74906 83995143 ~ 83995579 (-)
G553609 NA non-coding upstream 80090 84000327 ~ 84003271 (-)
G553491 NA other downstream 40527 83876214 ~ 83879504 (-)
G552980 NA other downstream 546835 83345201 ~ 83373196 (-)
G552584 LOC106587709 other downstream 1253586 82665477 ~ 82666445 (-)
G552558 NA other downstream 1299787 82612678 ~ 82620244 (-)
G552571 NA other downstream 1302837 82609918 ~ 82617194 (-)
G553707 NA other upstream 177775 84098012 ~ 84175022 (-)
G554191 NA other upstream 731850 84652087 ~ 84652416 (-)
LOC110517996 cers3 other upstream 793471 84699131 ~ 84727986 (-)
G554286 LOC106591282 other upstream 980131 84900368 ~ 84914202 (-)

Expression


G553516 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G553516 Expression in each Bioproject

Bar chart with 3 bars.
G553516 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network