G553609



Basic Information


Item Value
gene id G553609
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 84000327 ~ 84003271 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU627112
acaacagaccctaccttctcaggccaggtctctcacacacaagactaacaacagaccctaccttctcaggccaggtaaaacacacacaggactaacaagagaccctaccttctcaggccaggtctctcacacacaggactaacaagagaccctaccttctcaggccaggtctctcacacacaggactaacaagagaccctaccttctcaggccaggtctctcacacacaggactaacaacagaccctaccttctcaggccaggtctctcacacacaggactaacaacagaccctaccttctcaggccaggtctctcacacacaggactaacaacagaccctaccttctcaggccaggtaaaacacacacaggactaacaacagaccctaccttctcaggccaggtaaaacacac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU627112 True 414 lncRNA 0.52 2 84000327 84003271

Neighbor


gene id symbol gene type direction distance location
LOC110526720 LOC106562647 coding downstream 46028 83925574 ~ 83954299 (-)
LOC118964944 cemip coding downstream 88327 83756223 ~ 83912000 (-)
LOC110526992 NA coding downstream 131628 83866408 ~ 83868699 (-)
LOC110526710 mesd1 coding downstream 261612 83736836 ~ 83738715 (-)
LOC100136088 LOC106587743 coding downstream 295363 83647271 ~ 83704964 (-)
LOC110506870 fah coding upstream 222990 84226261 ~ 84250541 (-)
LOC110506882 LOC106562652 coding upstream 247725 84250996 ~ 84267954 (-)
LOC118964949 NA coding upstream 274984 84278255 ~ 84278855 (-)
LOC118964948 NA coding upstream 275626 84278897 ~ 84280568 (-)
LOC110512412 LOC106562588 coding upstream 362418 84363849 ~ 84413230 (-)
G553613 NA non-coding downstream 4748 83995143 ~ 83995579 (-)
G553550 NA non-coding downstream 28808 83971257 ~ 83971519 (-)
G553547 NA non-coding downstream 30481 83969600 ~ 83969846 (-)
G553529 NA non-coding downstream 45104 83954938 ~ 83955223 (-)
G553516 NA non-coding downstream 80090 83920031 ~ 83920237 (-)
G553615 NA non-coding upstream 475 84003746 ~ 84004022 (-)
G553617 NA non-coding upstream 8995 84012266 ~ 84016135 (-)
G553632 NA non-coding upstream 62713 84065984 ~ 84066313 (-)
G553635 NA non-coding upstream 75589 84078860 ~ 84079334 (-)
LOC110526723 arnt2 non-coding upstream 82514 83978404 ~ 84089424 (-)
G553491 NA other downstream 120823 83876214 ~ 83879504 (-)
G552980 NA other downstream 627131 83345201 ~ 83373196 (-)
G552584 LOC106587709 other downstream 1333882 82665477 ~ 82666445 (-)
G552558 NA other downstream 1380083 82612678 ~ 82620244 (-)
G553707 NA other upstream 94741 84098012 ~ 84175022 (-)
G554191 NA other upstream 648816 84652087 ~ 84652416 (-)
LOC110517996 cers3 other upstream 710437 84699131 ~ 84727986 (-)
G554286 LOC106591282 other upstream 897097 84900368 ~ 84914202 (-)
G554658 NA other upstream 1207483 85210754 ~ 85211990 (-)

Expression


G553609 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G553609 Expression in each Bioproject

Bar chart with 17 bars.
G553609 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network