G555108



Basic Information


Item Value
gene id G555108
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 85991353 ~ 85992058 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU628993
ctccctctttacctctgtagtctggtctccttccccaccagcaggtaaactccctctttacctctgtagtctggtctccttcaccaccagcaggtaaactccctctttacctctgtagtctggtctccttcaccaccaacaggtaaactccctctttacctctgtagtctggtctccttcaccaccagcaggtaaactccctctttacctctgtagtctggtctccttccccaccagcaggtaaactccctctgtagtctggtctccttccccaccagcaggtaaactccctctgtagtctggtctccttccccaccagcaggtaaactccctctttacctctgtagtctggtctccttcaccaccagcag
>TU628994
ctccctctttacctctgtagtctggtctccttccccaccagcaggtaaactccctctttacctctgtagtctggtctccttcaccaccagcaggtaaactccctctgtagtctggtctccttccccaccagcaggtaaactccctctttacctctgtagtctggtctccttccccaccagcaggtaaactcactatttacctctgtagtctggtatccttcaccaccaacaggtaaactccctctttacctctgtagtctggtctccttcaccaccagcag

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU628993 False 371 lncRNA 0.53 3 85991353 85992058
TU628994 True 281 lncRNA 0.52 2 85991353 85992058
Loading

Neighbor


gene id symbol gene type direction distance location
elp4 elp4 coding downstream 56346 85812100 ~ 85935007 (-)
LOC110506939 LOC106596505 coding downstream 235025 85741675 ~ 85779604 (-)
eif3m csn7 coding downstream 311243 85673680 ~ 85680110 (-)
LOC110506935 LOC106562570 coding downstream 321568 85664502 ~ 85669785 (-)
LOC118936664 LOC106562605 coding downstream 327062 85642286 ~ 85664291 (-)
LOC118964954 NA coding upstream 349840 86341898 ~ 86346739 (-)
LOC118964956 rabp1 coding upstream 420534 86412450 ~ 86424523 (-)
LOC110526738 LOC106587653 coding upstream 435474 86427532 ~ 86432060 (-)
LOC110526741 NA coding upstream 447557 86439615 ~ 86447991 (-)
LOC110526766 LOC106562456 coding upstream 558208 86550266 ~ 86555102 (-)
G555085 NA non-coding downstream 24309 85966117 ~ 85967044 (-)
G555074 LOC106562586 non-coding downstream 34122 85948623 ~ 85957231 (-)
G555053 NA non-coding downstream 83930 85907148 ~ 85907423 (-)
G554998 NA non-coding downstream 186641 85803840 ~ 85804712 (-)
G555117 NA non-coding upstream 12421 86004479 ~ 86004961 (-)
G555129 NA non-coding upstream 30916 86022974 ~ 86023213 (-)
G555131 NA non-coding upstream 31749 86023807 ~ 86024571 (-)
G555147 NA non-coding upstream 66417 86058475 ~ 86058703 (-)
G555153 NA non-coding upstream 72658 86064716 ~ 86064920 (-)
G554819 NA other downstream 358666 85630576 ~ 85632687 (-)
LOC110506192 LOC106593648 other downstream 386281 85604261 ~ 85643457 (-)
G554679 NA other downstream 674239 85240999 ~ 85317114 (-)
G555590 LOC106587652 other upstream 400689 86392747 ~ 86393060 (-)
G555606 NA other upstream 442883 86434941 ~ 86437902 (-)
G555617 NA other upstream 463066 86455124 ~ 86457965 (-)
LOC110506946 LOC106562772 other upstream 1465919 87456447 ~ 87498104 (-)

Expression


G555108 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 60.
End of interactive chart.

G555108 Expression in each Bioproject

Bar chart with 19 bars.
G555108 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network