G555129



Basic Information


Item Value
gene id G555129
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 86022974 ~ 86023213 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU629024
GTAGTAAACTGAAGTCAATTCAGGGAGTAAACTGAAGTCAATTCAGGTAGTAAATTCAAGTCAATTCAGGGAGTAAACTGAAGTCAATTAAGGGAGTAAACTGAAGTAAATTCAGGTAGTAAACTTAAGTCAATTCAGGTAGTAAACTCAAGTCAATTCAGGGAGTAAACTGAAGTCAATTCAGGTAGTAAACTCAAGTCAATTCAGGGAGTAAACT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU629024 True 217 lncRNA 0.35 2 86022974 86023213
Loading

Neighbor


gene id symbol gene type direction distance location
elp4 elp4 coding downstream 87967 85812100 ~ 85935007 (-)
LOC110506939 LOC106596505 coding downstream 266646 85741675 ~ 85779604 (-)
eif3m csn7 coding downstream 342864 85673680 ~ 85680110 (-)
LOC110506935 LOC106562570 coding downstream 353189 85664502 ~ 85669785 (-)
LOC118936664 LOC106562605 coding downstream 358683 85642286 ~ 85664291 (-)
LOC118964954 NA coding upstream 318685 86341898 ~ 86346739 (-)
LOC118964956 rabp1 coding upstream 389379 86412450 ~ 86424523 (-)
LOC110526738 LOC106587653 coding upstream 404319 86427532 ~ 86432060 (-)
LOC110526741 NA coding upstream 416402 86439615 ~ 86447991 (-)
LOC110526766 LOC106562456 coding upstream 527053 86550266 ~ 86555102 (-)
G555117 NA non-coding downstream 18013 86004479 ~ 86004961 (-)
G555108 NA non-coding downstream 30916 85991353 ~ 85992058 (-)
G555085 NA non-coding downstream 55930 85966117 ~ 85967044 (-)
G555074 LOC106562586 non-coding downstream 65743 85948623 ~ 85957231 (-)
G555053 NA non-coding downstream 115551 85907148 ~ 85907423 (-)
G555131 NA non-coding upstream 594 86023807 ~ 86024571 (-)
G555147 NA non-coding upstream 35262 86058475 ~ 86058703 (-)
G555153 NA non-coding upstream 41503 86064716 ~ 86064920 (-)
G555159 NA non-coding upstream 47544 86070757 ~ 86071019 (-)
G555168 NA non-coding upstream 72087 86095300 ~ 86095700 (-)
G554819 NA other downstream 390287 85630576 ~ 85632687 (-)
LOC110506192 LOC106593648 other downstream 417902 85604261 ~ 85643457 (-)
G554679 NA other downstream 705860 85240999 ~ 85317114 (-)
G555590 LOC106587652 other upstream 369534 86392747 ~ 86393060 (-)
G555606 NA other upstream 411728 86434941 ~ 86437902 (-)
G555617 NA other upstream 431911 86455124 ~ 86457965 (-)
LOC110506946 LOC106562772 other upstream 1434764 87456447 ~ 87498104 (-)

Expression


G555129 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G555129 Expression in each Bioproject

Bar chart with 2 bars.
G555129 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network