G556640



Basic Information


Item Value
gene id G556640
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 87900106 ~ 87901997 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU630852
cacacacacacacactacaaggaGTGAGACAAGGGATGGAAAGAATTACATTACAATTGTGGTTGTTTTCGGACTCTCACCCAAAGGCTGCCCAGTCAAACGAAACCAGTTGAATCACCAGCCGTTTGCTGTGGTCAGACATGTTCTTATAGAGCCCTCTCAGGACACACAGCAGTCTGGGGTCCGGGAGACAGGACGGTCATCCCTTCAGCTGGTTGAGGTGGTCAGACATGTTCTTATAGAGC
>TU630850
GTTGAGGTTTAGACCTGAAGTGAACCACTTATGCTGTTGAAGTGAAAGGATTACATAGTTAGTTAGGTAACCATTGGTAAACTGTTAGTCATTACATATCATTAGTCAGTGTGTCAACATCTGCAAATACAATGTATCTGTATAGAACAACATCTCTGAGGAGTTGTAATCATGCAGTTTATCAATCCAGACCTTTAATACAGTTTATCAATCCAGACCAGTAATACAGATTATCAATCCAGACCTGTAATACAGTTTATCAATCCAGACCTGTAATACAGATTATCAATCCAGACCTTTAATACAGTTTATCAATCCAGACCTGTAATACAGATTATCAATCCAGACCTTTAATACAGT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU630852 False 245 lncRNA 0.50 2 87900106 87900530
TU630850 True 360 lncRNA 0.34 2 87901040 87901997
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118964960 NA coding upstream 135257 87759569 ~ 87764850 (+)
st3gal-i st3gal-i coding upstream 140541 87749056 ~ 87759565 (+)
LOC110526759 LOC106562792 coding upstream 202525 87694999 ~ 87697581 (+)
LOC118964958 senp8 coding upstream 701006 87196781 ~ 87199100 (+)
LOC110526767 LOC106587658 coding upstream 1355602 86534461 ~ 86544504 (+)
LOC118964961 NA coding downstream 79334 87981331 ~ 87986876 (+)
LOC110526997 glce coding downstream 136100 88038097 ~ 88121871 (+)
LOC110526779 LOC106595196 coding downstream 234618 88136615 ~ 88148567 (+)
LOC110526780 LOC106562699 coding downstream 247057 88149054 ~ 88168508 (+)
LOC118965052 LOC106562560 coding downstream 325789 88227768 ~ 88230932 (+)
G556634 NA non-coding upstream 13929 87884669 ~ 87886177 (+)
G556632 NA non-coding upstream 16581 87883313 ~ 87883525 (+)
G556629 NA non-coding upstream 21621 87877849 ~ 87878485 (+)
G556586 NA non-coding upstream 105316 87794479 ~ 87794790 (+)
G556573 NA non-coding upstream 126774 87771273 ~ 87773332 (+)
G556652 NA non-coding downstream 10583 87912580 ~ 87912956 (+)
G556666 NA non-coding downstream 45466 87947463 ~ 87948550 (+)
G556669 NA non-coding downstream 49313 87951310 ~ 87951871 (+)
G556670 NA non-coding downstream 52887 87954884 ~ 87955710 (+)
G556675 NA non-coding downstream 67312 87969309 ~ 87970603 (+)
G556150 LOC106562774 other upstream 603120 87296518 ~ 87296986 (+)
G555456 NA other upstream 1329872 86569073 ~ 86570234 (+)
G555405 LOC106587654 other upstream 1449494 86449844 ~ 86450612 (+)
LOC118964955 LOC106592958 other upstream 1548222 86350925 ~ 86353193 (+)
G557241 NA other downstream 678332 88580329 ~ 88584055 (+)
G557324 NA other downstream 844306 88746303 ~ 88747223 (+)
G557562 NA other downstream 1132813 89034810 ~ 89035260 (+)

Expression


G556640 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G556640 Expression in each Bioproject

Bar chart with 16 bars.
G556640 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network