G556675



Basic Information


Item Value
gene id G556675
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 87969309 ~ 87970603 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU630901
GATATGATGTAACCTTCAGGTGAAACTGAGATATTAAACCTACAGATATGATGTAACCTTCAGGTGAATCTGAGGTATTGGTTCTACAGATATGATGTAACCTTCAGGTGAATCTGAGGTATTAGTTCTACAGATATGATGTAACCTTCAGGTGAATCTGAAGCATTAGTTCTACAGATATGATGTAACCTTCAGGTGAATTTGAGATATTAAACCTACAGATATGATGTAACCTTCAGGTGAATCTGAGGTATTGGTTCTACAGATATGATGTAACCTTCAGGTGAATCTGAGGTATTAGTTCTACAGATATGATGTAACCTTCAGGTGAATCTGAGGTATTAGTTCTACAGATATGATGTAACCTTCAGGTGAATCTGAGGTATGGGTGCTACAGATATGATGTAACCTTCAG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU630901 True 415 lncRNA 0.37 3 87969309 87970603
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118964960 NA coding upstream 204460 87759569 ~ 87764850 (+)
st3gal-i st3gal-i coding upstream 209744 87749056 ~ 87759565 (+)
LOC110526759 LOC106562792 coding upstream 271728 87694999 ~ 87697581 (+)
LOC118964958 senp8 coding upstream 770209 87196781 ~ 87199100 (+)
LOC110526767 LOC106587658 coding upstream 1424805 86534461 ~ 86544504 (+)
LOC118964961 NA coding downstream 10728 87981331 ~ 87986876 (+)
LOC110526997 glce coding downstream 67494 88038097 ~ 88121871 (+)
LOC110526779 LOC106595196 coding downstream 166012 88136615 ~ 88148567 (+)
LOC110526780 LOC106562699 coding downstream 178451 88149054 ~ 88168508 (+)
LOC118965052 LOC106562560 coding downstream 257183 88227768 ~ 88230932 (+)
G556670 NA non-coding upstream 13599 87954884 ~ 87955710 (+)
G556669 NA non-coding upstream 17438 87951310 ~ 87951871 (+)
G556666 NA non-coding upstream 20759 87947463 ~ 87948550 (+)
G556652 NA non-coding upstream 56353 87912580 ~ 87912956 (+)
G556640 NA non-coding upstream 67312 87900106 ~ 87901997 (+)
LOC110526745 LOC106562700 non-coding downstream 20963 87897481 ~ 87996337 (+)
G556823 NA non-coding downstream 49245 88019848 ~ 88020166 (+)
G556830 NA non-coding downstream 57872 88028475 ~ 88028696 (+)
G556837 NA non-coding downstream 64311 88034914 ~ 88035182 (+)
G556150 LOC106562774 other upstream 672323 87296518 ~ 87296986 (+)
G555456 NA other upstream 1399075 86569073 ~ 86570234 (+)
G555405 LOC106587654 other upstream 1518697 86449844 ~ 86450612 (+)
LOC118964955 LOC106592958 other upstream 1617425 86350925 ~ 86353193 (+)
G557241 NA other downstream 609726 88580329 ~ 88584055 (+)
G557324 NA other downstream 775700 88746303 ~ 88747223 (+)
G557562 NA other downstream 1064207 89034810 ~ 89035260 (+)

Expression


G556675 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G556675 Expression in each Bioproject

Bar chart with 14 bars.
G556675 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network