G557990



Basic Information


Item Value
gene id G557990
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 89568775 ~ 89568988 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU632469
GGAACATCTCATATCCACACACTGACAGTGTACTTGACCTGGAACATCTCTCATATCCACACACTGACAGTGTACTTGACCTGGAACATCTCATATCCACACACTGACAGTGTACCTGACCTGGAACATCTCTCATATCCTCACACTGACAGTGTACTTGACCTGGAACATCTCATATCCACACACTGACAGTGTACTTGACCTGGAACATCTC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU632469 True 214 lncRNA 0.46 1 89568775 89568988

Neighbor


gene id symbol gene type direction distance location
LOC110506410 LOC106562560 coding upstream 1333838 88233366 ~ 88234937 (+)
LOC118965052 LOC106562560 coding upstream 1337843 88227768 ~ 88230932 (+)
LOC110526780 LOC106562699 coding upstream 1400267 88149054 ~ 88168508 (+)
LOC110526779 LOC106595196 coding upstream 1420208 88136615 ~ 88148567 (+)
LOC110526997 glce coding upstream 1446904 88038097 ~ 88121871 (+)
LOC110526792 LOC106562569 coding downstream 295456 89864444 ~ 89868058 (+)
LOC118965089 NA coding downstream 308097 89877085 ~ 89879935 (+)
LOC118965053 LOC106562510 coding downstream 313684 89882672 ~ 89892527 (+)
LOC110513766 LOC106593737 coding downstream 326332 89895320 ~ 89913857 (+)
LOC110527005 LOC106587903 coding downstream 364235 89933223 ~ 89950616 (+)
G557973 NA non-coding upstream 15232 89553314 ~ 89553543 (+)
G557964 NA non-coding upstream 23109 89544119 ~ 89545666 (+)
G557963 NA non-coding upstream 25093 89543414 ~ 89543682 (+)
G557953 NA non-coding upstream 48268 89520295 ~ 89520507 (+)
G557913 NA non-coding upstream 93944 89469462 ~ 89474831 (+)
G557998 NA non-coding downstream 5176 89574164 ~ 89574365 (+)
G558003 NA non-coding downstream 11649 89580637 ~ 89581157 (+)
G558036 NA non-coding downstream 40847 89609835 ~ 89610144 (+)
G558038 NA non-coding downstream 41299 89610287 ~ 89610487 (+)
G558049 NA non-coding downstream 56561 89625549 ~ 89630303 (+)
G557654 NA other upstream 427219 89141229 ~ 89141556 (+)
G557562 NA other upstream 533515 89034810 ~ 89035260 (+)
G557324 NA other upstream 821552 88746303 ~ 88747223 (+)
G557241 NA other upstream 984720 88580329 ~ 88584055 (+)
G558474 NA other downstream 556201 90125189 ~ 90125855 (+)
G558538 NA other downstream 690624 90259612 ~ 90260168 (+)
G558568 NA other downstream 732421 90301409 ~ 90304467 (+)
LOC118964964 LOC106562578 other downstream 755401 90324347 ~ 90329324 (+)
LOC118964965 LOC106562863 other downstream 848873 90417861 ~ 90424832 (+)

Expression


G557990 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G557990 Expression in each Bioproject

Bar chart with 8 bars.
G557990 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 250.
End of interactive chart.

Co-expression Network