G558148



Basic Information


Item Value
gene id G558148
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 89754246 ~ 89754551 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU632652
gtccaactactcctctccctggtcaaactactcctctccctggtccaactactcctctccctggtccagctactcctctcccgggtccaactactcctctccctggtccaactactcctctccctggtccaactactcctctccctggtccaactactcctctcccttgtccaactactcctctccctggtccaactactcctctccctggtccagctactcctctccctggtccaactactcctctccctggtccaactactcctctccctggtccaactactcctctccctggtccaactactc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU632652 True 306 lncRNA 0.57 1 89754246 89754551
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118964962 chst1 coding downstream 192957 89556379 ~ 89561289 (-)
trnag-ucc NA coding downstream 359272 89394903 ~ 89394974 (-)
LOC110509922 LOC106563534 coding downstream 407815 89317125 ~ 89346431 (-)
LOC110526791 LOC104927744 coding downstream 486754 89227541 ~ 89267492 (-)
LOC110526789 map2k5 coding downstream 642651 88974571 ~ 89111595 (-)
LOC110526793 LOC106587778 coding upstream 203364 89956035 ~ 89965389 (-)
LOC110506981 dh12b coding upstream 502693 90257244 ~ 90267943 (-)
LOC118965054 NA coding upstream 546835 90301386 ~ 90303985 (-)
LOC110506215 ttc17 coding upstream 548567 90303118 ~ 90324307 (-)
trpm5 trpm5 coding upstream 605878 90360429 ~ 90403385 (-)
G558135 NA non-coding downstream 14345 89739699 ~ 89739901 (-)
G558124 NA non-coding downstream 32225 89720475 ~ 89722021 (-)
G558087 NA non-coding downstream 112784 89641123 ~ 89641462 (-)
G558059 NA non-coding downstream 121239 89632791 ~ 89633007 (-)
G558055 NA non-coding downstream 123338 89628051 ~ 89630908 (-)
G558156 NA non-coding upstream 4184 89758735 ~ 89758963 (-)
G558165 NA non-coding upstream 13844 89768395 ~ 89768777 (-)
G558166 NA non-coding upstream 14421 89768972 ~ 89769391 (-)
G558168 NA non-coding upstream 14878 89769429 ~ 89769743 (-)
G558174 NA non-coding upstream 19444 89773995 ~ 89774208 (-)
G558051 NA other downstream 132491 89621348 ~ 89621755 (-)
G557663 NA other downstream 594361 89159224 ~ 89159885 (-)
LOC110526751 LOC106562707 other downstream 1968894 87773201 ~ 87860425 (-)
LOC110513865 LOC106562791 other downstream 2202856 87546236 ~ 87693072 (-)
G558246 LOC106562569 other upstream 111417 89865968 ~ 89868057 (-)
G558339 LOC106587697 other upstream 219631 89974182 ~ 89981624 (-)
G559123 NA other upstream 1168547 90923098 ~ 90923835 (-)
G559162 NA other upstream 1236279 90990830 ~ 90992177 (-)
G559163 NA other upstream 1237885 90992436 ~ 90992949 (-)

Expression


G558148 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G558148 Expression in each Bioproject

Bar chart with 11 bars.
G558148 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network